ID: 1012986853

View in Genome Browser
Species Human (GRCh38)
Location 6:105884789-105884811
Sequence TGGATGTGGCAGGCACTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012986853_1012986860 12 Left 1012986853 6:105884789-105884811 CCTCAAAGTGCCTGCCACATCCA No data
Right 1012986860 6:105884824-105884846 AGCTCCTTGCTCCTCCCCATGGG No data
1012986853_1012986859 11 Left 1012986853 6:105884789-105884811 CCTCAAAGTGCCTGCCACATCCA No data
Right 1012986859 6:105884823-105884845 CAGCTCCTTGCTCCTCCCCATGG No data
1012986853_1012986862 20 Left 1012986853 6:105884789-105884811 CCTCAAAGTGCCTGCCACATCCA No data
Right 1012986862 6:105884832-105884854 GCTCCTCCCCATGGGATACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012986853 Original CRISPR TGGATGTGGCAGGCACTTTG AGG (reversed) Intergenic
No off target data available for this crispr