ID: 1012986854

View in Genome Browser
Species Human (GRCh38)
Location 6:105884799-105884821
Sequence GCAATGGGACTGGATGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012986854_1012986860 2 Left 1012986854 6:105884799-105884821 CCTGCCACATCCAGTCCCATTGC No data
Right 1012986860 6:105884824-105884846 AGCTCCTTGCTCCTCCCCATGGG No data
1012986854_1012986859 1 Left 1012986854 6:105884799-105884821 CCTGCCACATCCAGTCCCATTGC No data
Right 1012986859 6:105884823-105884845 CAGCTCCTTGCTCCTCCCCATGG No data
1012986854_1012986862 10 Left 1012986854 6:105884799-105884821 CCTGCCACATCCAGTCCCATTGC No data
Right 1012986862 6:105884832-105884854 GCTCCTCCCCATGGGATACCAGG No data
1012986854_1012986867 27 Left 1012986854 6:105884799-105884821 CCTGCCACATCCAGTCCCATTGC No data
Right 1012986867 6:105884849-105884871 ACCAGGTGTTTTCATGCCCTCGG No data
1012986854_1012986869 28 Left 1012986854 6:105884799-105884821 CCTGCCACATCCAGTCCCATTGC No data
Right 1012986869 6:105884850-105884872 CCAGGTGTTTTCATGCCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012986854 Original CRISPR GCAATGGGACTGGATGTGGC AGG (reversed) Intergenic
No off target data available for this crispr