ID: 1012986856

View in Genome Browser
Species Human (GRCh38)
Location 6:105884809-105884831
Sequence AAGGAGCTGTGCAATGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012986856_1012986867 17 Left 1012986856 6:105884809-105884831 CCAGTCCCATTGCACAGCTCCTT No data
Right 1012986867 6:105884849-105884871 ACCAGGTGTTTTCATGCCCTCGG No data
1012986856_1012986860 -8 Left 1012986856 6:105884809-105884831 CCAGTCCCATTGCACAGCTCCTT No data
Right 1012986860 6:105884824-105884846 AGCTCCTTGCTCCTCCCCATGGG No data
1012986856_1012986869 18 Left 1012986856 6:105884809-105884831 CCAGTCCCATTGCACAGCTCCTT No data
Right 1012986869 6:105884850-105884872 CCAGGTGTTTTCATGCCCTCGGG No data
1012986856_1012986862 0 Left 1012986856 6:105884809-105884831 CCAGTCCCATTGCACAGCTCCTT No data
Right 1012986862 6:105884832-105884854 GCTCCTCCCCATGGGATACCAGG No data
1012986856_1012986859 -9 Left 1012986856 6:105884809-105884831 CCAGTCCCATTGCACAGCTCCTT No data
Right 1012986859 6:105884823-105884845 CAGCTCCTTGCTCCTCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012986856 Original CRISPR AAGGAGCTGTGCAATGGGAC TGG (reversed) Intergenic
No off target data available for this crispr