ID: 1012986860

View in Genome Browser
Species Human (GRCh38)
Location 6:105884824-105884846
Sequence AGCTCCTTGCTCCTCCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012986850_1012986860 22 Left 1012986850 6:105884779-105884801 CCTCAGCCCTCCTCAAAGTGCCT No data
Right 1012986860 6:105884824-105884846 AGCTCCTTGCTCCTCCCCATGGG No data
1012986848_1012986860 27 Left 1012986848 6:105884774-105884796 CCCAACCTCAGCCCTCCTCAAAG No data
Right 1012986860 6:105884824-105884846 AGCTCCTTGCTCCTCCCCATGGG No data
1012986854_1012986860 2 Left 1012986854 6:105884799-105884821 CCTGCCACATCCAGTCCCATTGC No data
Right 1012986860 6:105884824-105884846 AGCTCCTTGCTCCTCCCCATGGG No data
1012986853_1012986860 12 Left 1012986853 6:105884789-105884811 CCTCAAAGTGCCTGCCACATCCA No data
Right 1012986860 6:105884824-105884846 AGCTCCTTGCTCCTCCCCATGGG No data
1012986851_1012986860 16 Left 1012986851 6:105884785-105884807 CCCTCCTCAAAGTGCCTGCCACA No data
Right 1012986860 6:105884824-105884846 AGCTCCTTGCTCCTCCCCATGGG No data
1012986852_1012986860 15 Left 1012986852 6:105884786-105884808 CCTCCTCAAAGTGCCTGCCACAT No data
Right 1012986860 6:105884824-105884846 AGCTCCTTGCTCCTCCCCATGGG No data
1012986849_1012986860 26 Left 1012986849 6:105884775-105884797 CCAACCTCAGCCCTCCTCAAAGT No data
Right 1012986860 6:105884824-105884846 AGCTCCTTGCTCCTCCCCATGGG No data
1012986856_1012986860 -8 Left 1012986856 6:105884809-105884831 CCAGTCCCATTGCACAGCTCCTT No data
Right 1012986860 6:105884824-105884846 AGCTCCTTGCTCCTCCCCATGGG No data
1012986855_1012986860 -2 Left 1012986855 6:105884803-105884825 CCACATCCAGTCCCATTGCACAG No data
Right 1012986860 6:105884824-105884846 AGCTCCTTGCTCCTCCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012986860 Original CRISPR AGCTCCTTGCTCCTCCCCAT GGG Intergenic
No off target data available for this crispr