ID: 1012986862

View in Genome Browser
Species Human (GRCh38)
Location 6:105884832-105884854
Sequence GCTCCTCCCCATGGGATACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012986851_1012986862 24 Left 1012986851 6:105884785-105884807 CCCTCCTCAAAGTGCCTGCCACA No data
Right 1012986862 6:105884832-105884854 GCTCCTCCCCATGGGATACCAGG No data
1012986853_1012986862 20 Left 1012986853 6:105884789-105884811 CCTCAAAGTGCCTGCCACATCCA No data
Right 1012986862 6:105884832-105884854 GCTCCTCCCCATGGGATACCAGG No data
1012986857_1012986862 -5 Left 1012986857 6:105884814-105884836 CCCATTGCACAGCTCCTTGCTCC No data
Right 1012986862 6:105884832-105884854 GCTCCTCCCCATGGGATACCAGG No data
1012986852_1012986862 23 Left 1012986852 6:105884786-105884808 CCTCCTCAAAGTGCCTGCCACAT No data
Right 1012986862 6:105884832-105884854 GCTCCTCCCCATGGGATACCAGG No data
1012986858_1012986862 -6 Left 1012986858 6:105884815-105884837 CCATTGCACAGCTCCTTGCTCCT No data
Right 1012986862 6:105884832-105884854 GCTCCTCCCCATGGGATACCAGG No data
1012986855_1012986862 6 Left 1012986855 6:105884803-105884825 CCACATCCAGTCCCATTGCACAG No data
Right 1012986862 6:105884832-105884854 GCTCCTCCCCATGGGATACCAGG No data
1012986854_1012986862 10 Left 1012986854 6:105884799-105884821 CCTGCCACATCCAGTCCCATTGC No data
Right 1012986862 6:105884832-105884854 GCTCCTCCCCATGGGATACCAGG No data
1012986850_1012986862 30 Left 1012986850 6:105884779-105884801 CCTCAGCCCTCCTCAAAGTGCCT No data
Right 1012986862 6:105884832-105884854 GCTCCTCCCCATGGGATACCAGG No data
1012986856_1012986862 0 Left 1012986856 6:105884809-105884831 CCAGTCCCATTGCACAGCTCCTT No data
Right 1012986862 6:105884832-105884854 GCTCCTCCCCATGGGATACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012986862 Original CRISPR GCTCCTCCCCATGGGATACC AGG Intergenic
No off target data available for this crispr