ID: 1012986869

View in Genome Browser
Species Human (GRCh38)
Location 6:105884850-105884872
Sequence CCAGGTGTTTTCATGCCCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012986857_1012986869 13 Left 1012986857 6:105884814-105884836 CCCATTGCACAGCTCCTTGCTCC No data
Right 1012986869 6:105884850-105884872 CCAGGTGTTTTCATGCCCTCGGG No data
1012986863_1012986869 -8 Left 1012986863 6:105884835-105884857 CCTCCCCATGGGATACCAGGTGT No data
Right 1012986869 6:105884850-105884872 CCAGGTGTTTTCATGCCCTCGGG No data
1012986861_1012986869 -1 Left 1012986861 6:105884828-105884850 CCTTGCTCCTCCCCATGGGATAC No data
Right 1012986869 6:105884850-105884872 CCAGGTGTTTTCATGCCCTCGGG No data
1012986854_1012986869 28 Left 1012986854 6:105884799-105884821 CCTGCCACATCCAGTCCCATTGC No data
Right 1012986869 6:105884850-105884872 CCAGGTGTTTTCATGCCCTCGGG No data
1012986858_1012986869 12 Left 1012986858 6:105884815-105884837 CCATTGCACAGCTCCTTGCTCCT No data
Right 1012986869 6:105884850-105884872 CCAGGTGTTTTCATGCCCTCGGG No data
1012986855_1012986869 24 Left 1012986855 6:105884803-105884825 CCACATCCAGTCCCATTGCACAG No data
Right 1012986869 6:105884850-105884872 CCAGGTGTTTTCATGCCCTCGGG No data
1012986856_1012986869 18 Left 1012986856 6:105884809-105884831 CCAGTCCCATTGCACAGCTCCTT No data
Right 1012986869 6:105884850-105884872 CCAGGTGTTTTCATGCCCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012986869 Original CRISPR CCAGGTGTTTTCATGCCCTC GGG Intergenic
No off target data available for this crispr