ID: 1012987457

View in Genome Browser
Species Human (GRCh38)
Location 6:105890101-105890123
Sequence CACACCTACCACCTAGATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012987455_1012987457 -8 Left 1012987455 6:105890086-105890108 CCCAGGAGCAATGAGCACACCTA No data
Right 1012987457 6:105890101-105890123 CACACCTACCACCTAGATAGTGG No data
1012987453_1012987457 25 Left 1012987453 6:105890053-105890075 CCGTTTGCTGACAGGGTCTGGAA No data
Right 1012987457 6:105890101-105890123 CACACCTACCACCTAGATAGTGG No data
1012987456_1012987457 -9 Left 1012987456 6:105890087-105890109 CCAGGAGCAATGAGCACACCTAC No data
Right 1012987457 6:105890101-105890123 CACACCTACCACCTAGATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012987457 Original CRISPR CACACCTACCACCTAGATAG TGG Intergenic
No off target data available for this crispr