ID: 1012988503

View in Genome Browser
Species Human (GRCh38)
Location 6:105900194-105900216
Sequence TTGAAAAAGCATGATGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012988495_1012988503 15 Left 1012988495 6:105900156-105900178 CCCACCTCTCACTAGAAGTGTCA No data
Right 1012988503 6:105900194-105900216 TTGAAAAAGCATGATGGGGGAGG No data
1012988496_1012988503 14 Left 1012988496 6:105900157-105900179 CCACCTCTCACTAGAAGTGTCAC No data
Right 1012988503 6:105900194-105900216 TTGAAAAAGCATGATGGGGGAGG No data
1012988497_1012988503 11 Left 1012988497 6:105900160-105900182 CCTCTCACTAGAAGTGTCACCAT No data
Right 1012988503 6:105900194-105900216 TTGAAAAAGCATGATGGGGGAGG No data
1012988498_1012988503 -8 Left 1012988498 6:105900179-105900201 CCATTTTTCTTTTCTTTGAAAAA No data
Right 1012988503 6:105900194-105900216 TTGAAAAAGCATGATGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012988503 Original CRISPR TTGAAAAAGCATGATGGGGG AGG Intergenic
No off target data available for this crispr