ID: 1012992143

View in Genome Browser
Species Human (GRCh38)
Location 6:105936937-105936959
Sequence AGCTACCAACTGGTGGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012992143_1012992147 12 Left 1012992143 6:105936937-105936959 CCCAGTTCCACCAGTTGGTAGCT No data
Right 1012992147 6:105936972-105936994 ACTTCAGTTTCTTCATTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012992143 Original CRISPR AGCTACCAACTGGTGGAACT GGG (reversed) Intergenic
No off target data available for this crispr