ID: 1012995639

View in Genome Browser
Species Human (GRCh38)
Location 6:105970505-105970527
Sequence TGCGTACTTAAAATAATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012995639_1012995641 6 Left 1012995639 6:105970505-105970527 CCTTCAATTATTTTAAGTACGCA No data
Right 1012995641 6:105970534-105970556 AGTGGAATTGCCAGATCACATGG 0: 4
1: 35
2: 287
3: 1598
4: 6077

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012995639 Original CRISPR TGCGTACTTAAAATAATTGA AGG (reversed) Intergenic
No off target data available for this crispr