ID: 1012995639 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:105970505-105970527 |
| Sequence | TGCGTACTTAAAATAATTGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1012995639_1012995641 | 6 | Left | 1012995639 | 6:105970505-105970527 | CCTTCAATTATTTTAAGTACGCA | No data | ||
| Right | 1012995641 | 6:105970534-105970556 | AGTGGAATTGCCAGATCACATGG | 0: 4 1: 35 2: 287 3: 1598 4: 6077 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1012995639 | Original CRISPR | TGCGTACTTAAAATAATTGA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||