ID: 1012996541

View in Genome Browser
Species Human (GRCh38)
Location 6:105981255-105981277
Sequence GGGCAGGGACCCCGAATCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012996531_1012996541 0 Left 1012996531 6:105981232-105981254 CCAGACGGATGCGGGCGGTCCCC No data
Right 1012996541 6:105981255-105981277 GGGCAGGGACCCCGAATCCGGGG No data
1012996530_1012996541 1 Left 1012996530 6:105981231-105981253 CCCAGACGGATGCGGGCGGTCCC No data
Right 1012996541 6:105981255-105981277 GGGCAGGGACCCCGAATCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012996541 Original CRISPR GGGCAGGGACCCCGAATCCG GGG Intergenic
No off target data available for this crispr