ID: 1012997813

View in Genome Browser
Species Human (GRCh38)
Location 6:105991290-105991312
Sequence CTGTATATAAAAATAAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012997807_1012997813 29 Left 1012997807 6:105991238-105991260 CCAAAGATTGAAGCAAATTGCTT No data
Right 1012997813 6:105991290-105991312 CTGTATATAAAAATAAAGCATGG No data
1012997809_1012997813 -5 Left 1012997809 6:105991272-105991294 CCTTCTCCCTAATCAAACCTGTA No data
Right 1012997813 6:105991290-105991312 CTGTATATAAAAATAAAGCATGG No data
1012997808_1012997813 -4 Left 1012997808 6:105991271-105991293 CCCTTCTCCCTAATCAAACCTGT No data
Right 1012997813 6:105991290-105991312 CTGTATATAAAAATAAAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012997813 Original CRISPR CTGTATATAAAAATAAAGCA TGG Intergenic
No off target data available for this crispr