ID: 1012998221

View in Genome Browser
Species Human (GRCh38)
Location 6:105994239-105994261
Sequence AGAGCCCGGGCCTCTTTAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1012998221_1012998228 -4 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1012998221 6:105994239-105994261 CCGCCTAAAGAGGCCCGGGCTCT 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1012998228 6:105994258-105994280 CTCTCCCCCGGGGTCGTTGTTGG 0: 1
1: 0
2: 0
3: 4
4: 68
1012998221_1012998233 13 Complete closest: None
total_pairs: 1
max_distance: 1000
Left 1012998221 6:105994239-105994261 CCGCCTAAAGAGGCCCGGGCTCT 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1012998233 6:105994275-105994297 TGTTGGAAAAGCAAATTCCACGG 0: 1
1: 1
2: 11
3: 124
4: 790

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1012998221 Original CRISPR AGAGCCCGGGCCTCTTTAGG CGG (reversed) Intergenic
900331696 1:2137999-2138021 AGAGCCCGGGCACAATTAGGCGG - Intronic
901442292 1:9285722-9285744 ACAGCCCCCGCCTCTTGAGGTGG - Intergenic
912623076 1:111185263-111185285 AGTGCCTGGGCCTCTCTAAGAGG + Intergenic
920028421 1:203018932-203018954 AGAGGTAGGGCCTTTTTAGGAGG - Intronic
920507577 1:206527344-206527366 AGAGGCTGGGCCTCTTTGAGTGG + Intronic
1064084871 10:12337914-12337936 GAAGCTGGGGCCTCTTTAGGGGG + Intergenic
1065212645 10:23419216-23419238 AGAGACAGGGCCTATTTAGGGGG + Intergenic
1065359211 10:24873554-24873576 AGAGGGAGGGCCTCTTTAGGAGG - Intronic
1066635217 10:37493125-37493147 GAAGCTGGGGCCTCTTTAGGAGG + Intergenic
1075513820 10:123093727-123093749 AGAGCCTGGGCCTTTTCTGGTGG + Intergenic
1077360635 11:2138945-2138967 CGAGCCCGGGCCTCGGGAGGGGG + Intronic
1078019869 11:7648039-7648061 AGAGCTGTGGCCTCATTAGGCGG - Intronic
1081968479 11:47183468-47183490 GGAGCTGGGGCCTCCTTAGGAGG - Intronic
1087340596 11:96901164-96901186 AGAGCCCGGACCTCTATAATGGG - Intergenic
1088971744 11:114780192-114780214 AGAGGCCGAGTCTCTTCAGGAGG + Intergenic
1089943171 11:122440670-122440692 AGAGCTCGGGCCTCTCTGCGGGG + Intergenic
1090273225 11:125402289-125402311 AGAGCCCAGGCTTCTTGTGGGGG + Intronic
1091189872 11:133682378-133682400 TGTGCTCGGGCCTCTTTAGAGGG - Intergenic
1092153453 12:6267060-6267082 AGGGCCCGGGACCCTTTGGGAGG - Intergenic
1096576588 12:52556589-52556611 GGAGTCAGGGCATCTTTAGGGGG + Intergenic
1106188189 13:27426771-27426793 ACAGCCAGGGCGTCTTTAAGAGG + Intronic
1106230177 13:27815415-27815437 AGATCCAGTGCCTTTTTAGGAGG - Intergenic
1117710283 14:58521406-58521428 AATGCCCGGGCCGCTGTAGGTGG + Intronic
1121174720 14:91882573-91882595 AGAGCCCGGGCTTTCTTACGTGG - Intronic
1122753554 14:103958435-103958457 AGAACATGGACCTCTTTAGGAGG - Intronic
1127995789 15:64152459-64152481 AGCCCCCGGGCCTCTGTGGGTGG + Intronic
1133887746 16:9846293-9846315 AAAGCAAGGGCCTTTTTAGGAGG + Intronic
1138203502 16:55107349-55107371 AGTGCCTGGGCTTCTTGAGGAGG + Intergenic
1138320138 16:56104711-56104733 GGAGGCAGGGCCTCTTTGGGAGG + Intergenic
1141649306 16:85384729-85384751 AGAGCCTGGGCTTCATTAGCTGG - Intergenic
1142143434 16:88482799-88482821 AAAGCCCGGGCCTCTAGAAGGGG + Intronic
1142336315 16:89491256-89491278 AGAGCCTGAGCCGCTTGAGGAGG + Intronic
1142689136 17:1594368-1594390 AGAACCTGTGCCTCTTTGGGAGG - Intronic
1148503250 17:48107677-48107699 AGAGCCCGGGCCTGTAGGGGCGG + Exonic
1159348833 18:67243661-67243683 AGAACACAGGCATCTTTAGGGGG - Intergenic
1161569442 19:5022515-5022537 AGAGCCCAGGCCTCAGGAGGAGG + Intronic
1162480543 19:10924562-10924584 AGAGCCCTGGGCTCTAGAGGAGG - Intronic
1166410798 19:42554434-42554456 AGAGCCTGGGCCTCTCATGGAGG + Intronic
1166966649 19:46533244-46533266 AGAGCCCAGGCCTCCTGCGGTGG + Intronic
925543771 2:4995637-4995659 AGAGCCTGCTCCTCTCTAGGGGG + Intergenic
929887781 2:45893895-45893917 AGAGCCCCAGCCTCTCCAGGAGG - Intronic
936916840 2:117648736-117648758 AGAGCCCACTCCTCTCTAGGGGG + Intergenic
936979399 2:118250360-118250382 AGCTCCTGGTCCTCTTTAGGGGG - Intergenic
937047307 2:118858658-118858680 AGAGCGAGCGCCTCTTTAGGTGG + Intergenic
939022956 2:136980504-136980526 CGTGGCCGGGCTTCTTTAGGTGG - Intronic
946478753 2:220033742-220033764 GGAGCCCAGGCCTCTGTTGGGGG + Intergenic
948466747 2:238155892-238155914 AGAGGCCGGGGGTCTTCAGGTGG - Intergenic
1172053555 20:32138272-32138294 AGAACCCTGGACTCTTTGGGAGG + Intronic
1172600029 20:36177181-36177203 AGAGTCCCTGCCTCTTTGGGTGG + Intronic
1174545394 20:51321444-51321466 AGAGCCCGGGTATCTTTTGGAGG - Intergenic
1174741687 20:53020545-53020567 AGAGCCAAGACCTCTTTATGGGG - Intronic
1175984838 20:62759471-62759493 CCAGCCTGGGCTTCTTTAGGTGG - Intronic
1181776126 22:25161297-25161319 AGAGCCCTGGCCTCAGTTGGTGG - Intronic
1182445307 22:30386536-30386558 AGAGCCAGGCCCTCCTTAGATGG - Intronic
1182701372 22:32242222-32242244 AGAGCCCTGGCTCCTTTAGTGGG - Intronic
1183285722 22:36961598-36961620 AGAGCCTGGGACTCTTAAGAAGG + Intergenic
955376685 3:58402957-58402979 AGACACCGGGTCTATTTAGGGGG - Intronic
955512859 3:59698672-59698694 TTAGCCAGGGCCTCTATAGGTGG + Intergenic
959591767 3:108090405-108090427 AGGGCCCGGGCCTCTTGCGATGG - Intronic
961388837 3:126540136-126540158 AGAGCCAGGGCCTGCTTGGGAGG - Intronic
966880189 3:184345663-184345685 AGGGCCCAGGCCCCATTAGGGGG - Intronic
970202843 4:13627389-13627411 AGAGCCCCTGGCTCTTGAGGTGG + Exonic
972762714 4:42122470-42122492 AGAGCACGGGCCTCTGTGGCTGG + Intronic
973573425 4:52262869-52262891 AGAGCCAGTACCTATTTAGGAGG - Intergenic
986169998 5:5307432-5307454 AGAGCCAGGGCCTCTGCAGCAGG - Intronic
988091477 5:26545707-26545729 AGAGCCTGGACATCTTTGGGTGG + Intergenic
988109883 5:26807084-26807106 AGAATGCGGGCCTCTGTAGGTGG - Intergenic
989718684 5:44497600-44497622 ATAGCCCAGGCCATTTTAGGAGG + Intergenic
992701447 5:79345215-79345237 AGAGCCCAGGAATCTTTTGGTGG - Intergenic
994428771 5:99628453-99628475 AGGGCCCAGGGCTCTTTAGTTGG + Intergenic
999144517 5:149383515-149383537 AGAGCCAGGACCTCCCTAGGGGG - Intronic
1006186135 6:32182678-32182700 AGAGCCTGTGCCTCTGGAGGAGG - Exonic
1009622418 6:66094689-66094711 AGAGACTGGGCCTCTATGGGGGG + Intergenic
1012998221 6:105994239-105994261 AGAGCCCGGGCCTCTTTAGGCGG - Intergenic
1017700332 6:157063333-157063355 AGAGCACCTGCCTCTTAAGGTGG - Intronic
1028618457 7:92797580-92797602 AGGGCCAGGGCCTTTTTAAGAGG - Intronic
1032795936 7:135276279-135276301 AGGGCGCGGGCCTCTGTAAGGGG - Intergenic
1036010438 8:4715865-4715887 AGAGCCAAGGACCCTTTAGGAGG - Intronic
1037831749 8:22193991-22194013 AGAGGTGGGGCCTCTATAGGGGG + Intronic
1037894424 8:22642310-22642332 ACAGCCCAGGCCTGTTTTGGGGG + Intronic
1038523390 8:28252700-28252722 AGAGCCTGGACCTCTTTACGTGG - Intergenic
1041829348 8:62135585-62135607 AGAGCCCTGGTTGCTTTAGGTGG + Intergenic
1047966230 8:130048863-130048885 AGAGGCCAGGCCTCTGTGGGAGG + Intergenic
1049352629 8:142172171-142172193 GGAACCCAGGCCTCTTTATGTGG - Intergenic
1053371121 9:37562470-37562492 AGAGCCTGGGCACCTCTAGGAGG + Intronic
1053414143 9:37935944-37935966 ATAGGCCGGGCGACTTTAGGAGG + Intronic
1060661883 9:125409304-125409326 CGAGGCCGGGCCGATTTAGGGGG + Intergenic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1203774448 EBV:64960-64982 GGTGCCCGGGCATCTTTACGGGG + Intergenic
1195829471 X:109040133-109040155 AGAGACAGGGCCTCCTTATGTGG - Intergenic
1196736882 X:118988059-118988081 AATGCCTGGGCATCTTTAGGGGG + Intronic