ID: 1013001971

View in Genome Browser
Species Human (GRCh38)
Location 6:106031939-106031961
Sequence GATGGACTCAAGCCTATTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013001971_1013001974 9 Left 1013001971 6:106031939-106031961 CCTTTAATAGGCTTGAGTCCATC No data
Right 1013001974 6:106031971-106031993 AAACTTATTTATTTTTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013001971 Original CRISPR GATGGACTCAAGCCTATTAA AGG (reversed) Intergenic
No off target data available for this crispr