ID: 1013001974

View in Genome Browser
Species Human (GRCh38)
Location 6:106031971-106031993
Sequence AAACTTATTTATTTTTCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013001971_1013001974 9 Left 1013001971 6:106031939-106031961 CCTTTAATAGGCTTGAGTCCATC No data
Right 1013001974 6:106031971-106031993 AAACTTATTTATTTTTCCTGAGG No data
1013001969_1013001974 21 Left 1013001969 6:106031927-106031949 CCATAGCTGTCTCCTTTAATAGG No data
Right 1013001974 6:106031971-106031993 AAACTTATTTATTTTTCCTGAGG No data
1013001967_1013001974 27 Left 1013001967 6:106031921-106031943 CCCAGACCATAGCTGTCTCCTTT No data
Right 1013001974 6:106031971-106031993 AAACTTATTTATTTTTCCTGAGG No data
1013001973_1013001974 -9 Left 1013001973 6:106031957-106031979 CCATCAGATGCAGGAAACTTATT No data
Right 1013001974 6:106031971-106031993 AAACTTATTTATTTTTCCTGAGG No data
1013001968_1013001974 26 Left 1013001968 6:106031922-106031944 CCAGACCATAGCTGTCTCCTTTA No data
Right 1013001974 6:106031971-106031993 AAACTTATTTATTTTTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013001974 Original CRISPR AAACTTATTTATTTTTCCTG AGG Intergenic
No off target data available for this crispr