ID: 1013004942

View in Genome Browser
Species Human (GRCh38)
Location 6:106063703-106063725
Sequence GAGATTAAAAAGATGGGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013004938_1013004942 -4 Left 1013004938 6:106063684-106063706 CCAAATCATTTGTTAGCTTGAGA No data
Right 1013004942 6:106063703-106063725 GAGATTAAAAAGATGGGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013004942 Original CRISPR GAGATTAAAAAGATGGGGCA AGG Intergenic
No off target data available for this crispr