ID: 1013013359

View in Genome Browser
Species Human (GRCh38)
Location 6:106139793-106139815
Sequence CATGGGAACCTATTTAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013013359_1013013366 27 Left 1013013359 6:106139793-106139815 CCTACTTTAAATAGGTTCCCATG No data
Right 1013013366 6:106139843-106139865 TGTCCCAACTCCCATAGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013013359 Original CRISPR CATGGGAACCTATTTAAAGT AGG (reversed) Intergenic
No off target data available for this crispr