ID: 1013015193

View in Genome Browser
Species Human (GRCh38)
Location 6:106154684-106154706
Sequence TGCTGTGCATGGAGGGGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013015183_1013015193 25 Left 1013015183 6:106154636-106154658 CCTGTAAAAGCAGATATTTGGGG No data
Right 1013015193 6:106154684-106154706 TGCTGTGCATGGAGGGGAAAGGG No data
1013015181_1013015193 26 Left 1013015181 6:106154635-106154657 CCCTGTAAAAGCAGATATTTGGG No data
Right 1013015193 6:106154684-106154706 TGCTGTGCATGGAGGGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013015193 Original CRISPR TGCTGTGCATGGAGGGGAAA GGG Intergenic
No off target data available for this crispr