ID: 1013015764

View in Genome Browser
Species Human (GRCh38)
Location 6:106159471-106159493
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013015764_1013015770 -3 Left 1013015764 6:106159471-106159493 CCCCGAGTCAGGGCTGTGATTCT No data
Right 1013015770 6:106159491-106159513 TCTGATCTGCAGTGTGGGGAAGG No data
1013015764_1013015777 29 Left 1013015764 6:106159471-106159493 CCCCGAGTCAGGGCTGTGATTCT No data
Right 1013015777 6:106159523-106159545 GGCCGAGGCCCACGGCAGAGGGG No data
1013015764_1013015773 14 Left 1013015764 6:106159471-106159493 CCCCGAGTCAGGGCTGTGATTCT No data
Right 1013015773 6:106159508-106159530 GGAAGGTGCTGGTATGGCCGAGG No data
1013015764_1013015767 -9 Left 1013015764 6:106159471-106159493 CCCCGAGTCAGGGCTGTGATTCT No data
Right 1013015767 6:106159485-106159507 TGTGATTCTGATCTGCAGTGTGG No data
1013015764_1013015776 28 Left 1013015764 6:106159471-106159493 CCCCGAGTCAGGGCTGTGATTCT No data
Right 1013015776 6:106159522-106159544 TGGCCGAGGCCCACGGCAGAGGG No data
1013015764_1013015775 27 Left 1013015764 6:106159471-106159493 CCCCGAGTCAGGGCTGTGATTCT No data
Right 1013015775 6:106159521-106159543 ATGGCCGAGGCCCACGGCAGAGG No data
1013015764_1013015774 21 Left 1013015764 6:106159471-106159493 CCCCGAGTCAGGGCTGTGATTCT No data
Right 1013015774 6:106159515-106159537 GCTGGTATGGCCGAGGCCCACGG No data
1013015764_1013015771 3 Left 1013015764 6:106159471-106159493 CCCCGAGTCAGGGCTGTGATTCT No data
Right 1013015771 6:106159497-106159519 CTGCAGTGTGGGGAAGGTGCTGG No data
1013015764_1013015772 8 Left 1013015764 6:106159471-106159493 CCCCGAGTCAGGGCTGTGATTCT No data
Right 1013015772 6:106159502-106159524 GTGTGGGGAAGGTGCTGGTATGG No data
1013015764_1013015768 -8 Left 1013015764 6:106159471-106159493 CCCCGAGTCAGGGCTGTGATTCT No data
Right 1013015768 6:106159486-106159508 GTGATTCTGATCTGCAGTGTGGG No data
1013015764_1013015769 -7 Left 1013015764 6:106159471-106159493 CCCCGAGTCAGGGCTGTGATTCT No data
Right 1013015769 6:106159487-106159509 TGATTCTGATCTGCAGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013015764 Original CRISPR AGAATCACAGCCCTGACTCG GGG (reversed) Intergenic
No off target data available for this crispr