ID: 1013015770

View in Genome Browser
Species Human (GRCh38)
Location 6:106159491-106159513
Sequence TCTGATCTGCAGTGTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013015766_1013015770 -5 Left 1013015766 6:106159473-106159495 CCGAGTCAGGGCTGTGATTCTGA No data
Right 1013015770 6:106159491-106159513 TCTGATCTGCAGTGTGGGGAAGG No data
1013015765_1013015770 -4 Left 1013015765 6:106159472-106159494 CCCGAGTCAGGGCTGTGATTCTG No data
Right 1013015770 6:106159491-106159513 TCTGATCTGCAGTGTGGGGAAGG No data
1013015764_1013015770 -3 Left 1013015764 6:106159471-106159493 CCCCGAGTCAGGGCTGTGATTCT No data
Right 1013015770 6:106159491-106159513 TCTGATCTGCAGTGTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013015770 Original CRISPR TCTGATCTGCAGTGTGGGGA AGG Intergenic
No off target data available for this crispr