ID: 1013018204

View in Genome Browser
Species Human (GRCh38)
Location 6:106180660-106180682
Sequence TTGAATAAACAGATGAATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013018203_1013018204 4 Left 1013018203 6:106180633-106180655 CCACTACTCTATTTGCTCAACAA No data
Right 1013018204 6:106180660-106180682 TTGAATAAACAGATGAATCGTGG No data
1013018202_1013018204 14 Left 1013018202 6:106180623-106180645 CCTAGAACTTCCACTACTCTATT No data
Right 1013018204 6:106180660-106180682 TTGAATAAACAGATGAATCGTGG No data
1013018201_1013018204 29 Left 1013018201 6:106180608-106180630 CCATGTCTTGTTCTTCCTAGAAC No data
Right 1013018204 6:106180660-106180682 TTGAATAAACAGATGAATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013018204 Original CRISPR TTGAATAAACAGATGAATCG TGG Intergenic
No off target data available for this crispr