ID: 1013020048

View in Genome Browser
Species Human (GRCh38)
Location 6:106205574-106205596
Sequence CCTGTTTAGCATTTTTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 1, 2: 2, 3: 39, 4: 412}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013020048_1013020051 -4 Left 1013020048 6:106205574-106205596 CCTGAAAAAAAATGCTAAACAGG 0: 1
1: 1
2: 2
3: 39
4: 412
Right 1013020051 6:106205593-106205615 CAGGAAAGGCCAACTAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013020048 Original CRISPR CCTGTTTAGCATTTTTTTTC AGG (reversed) Intronic
900439570 1:2647080-2647102 TCTCTTTATCTTTTTTTTTCAGG + Intronic
901198464 1:7453490-7453512 CCCTTTTAGCATTTTATGTCCGG + Intronic
902096314 1:13948801-13948823 CCTGTTTTGCTGTTATTTTCAGG + Intergenic
903071664 1:20729839-20729861 CAGGTGCAGCATTTTTTTTCTGG - Intronic
903731843 1:25502244-25502266 CCTGTGTATCAGCTTTTTTCTGG - Intergenic
904384877 1:30134658-30134680 CCTGGTTTGCACTTTTTTTTCGG - Intergenic
905625084 1:39484579-39484601 CCTTTTTATTATTTTTTTTAAGG + Exonic
905968676 1:42122398-42122420 CCAGTTTGGCAATTTTTTTCAGG - Intergenic
907678066 1:56537140-56537162 CCTTTTTTTCTTTTTTTTTCTGG - Intronic
908352326 1:63298612-63298634 CTTGTTTATCATGTTTTTTTTGG + Intergenic
908958603 1:69667837-69667859 CCTTTTTATCATTTGTTTTCTGG + Intronic
909082430 1:71129217-71129239 CATGTTTTGAAATTTTTTTCTGG + Intergenic
909531532 1:76687383-76687405 CCTGTTTAGCCTCTTTTCCCTGG + Intergenic
910247515 1:85156195-85156217 ATTGTTTAGAATTTTTATTCAGG + Intergenic
910494589 1:87812426-87812448 CCTTTTTAGCCTTTCTTTGCAGG - Intergenic
910697820 1:90039987-90040009 CATGTTCAGCATTTTTTAGCTGG - Intergenic
910822413 1:91365965-91365987 CCTGTTTTTTTTTTTTTTTCAGG - Intronic
913686647 1:121238422-121238444 CCTGTTTATCTTTTTATCTCAGG - Intronic
914038500 1:144026062-144026084 CCTGTTTATCTTTTTATCTCAGG - Intergenic
914150955 1:145041846-145041868 CCTGTTTATCTTTTTATCTCAGG + Intronic
914394780 1:147255013-147255035 CTTGATTAAGATTTTTTTTCTGG + Intronic
915634262 1:157175275-157175297 CCTCTTTAGCTTTTTTCTTTAGG + Intergenic
915701364 1:157799963-157799985 TCTCCTGAGCATTTTTTTTCCGG - Intronic
915786570 1:158619603-158619625 CCTGTTTATAATTTCTTTTGGGG + Intronic
916359378 1:163951483-163951505 TTTATTTAGAATTTTTTTTCTGG - Intergenic
917371635 1:174300180-174300202 CCTGTTTACCTCTCTTTTTCTGG + Intronic
917593751 1:176505896-176505918 TCAGTTTATCATTTTTTTACTGG - Intronic
919432909 1:197518916-197518938 GCTGTCTAGCATTCTTTTCCAGG + Intronic
920145571 1:203858354-203858376 CCAGAATAGCATTCTTTTTCAGG + Intergenic
920220654 1:204397563-204397585 CATACTTAGCATTTTTTTTGTGG - Intergenic
920473971 1:206256980-206257002 CCTGTTTATCTTTTTATCTCAGG - Intronic
921114399 1:212074334-212074356 CCTTTTTAAGATTTTGTTTCAGG + Intronic
922419058 1:225447282-225447304 CTTCTGTAGCATTTTCTTTCTGG - Intergenic
922434458 1:225590179-225590201 CCTGTTTGGCACTTTTTAACAGG - Intronic
923254558 1:232210512-232210534 CCTGATTAGCATTTTGCATCAGG - Intergenic
1063863333 10:10336687-10336709 CCTGTTTTTCATTATTTGTCTGG - Intergenic
1064183508 10:13140402-13140424 CATCTTTTGAATTTTTTTTCAGG + Intergenic
1064363515 10:14686771-14686793 TCAGTTTAGCATTTCTTCTCAGG - Intronic
1066230744 10:33430491-33430513 CCTGTTTAACTTTCTTTTCCAGG - Intergenic
1067571473 10:47374647-47374669 CATGGTTAGGCTTTTTTTTCTGG - Intronic
1067670380 10:48315126-48315148 CCTTTTCAGAAGTTTTTTTCTGG + Intronic
1068189021 10:53625790-53625812 ACAGTTTAGCGTTATTTTTCAGG + Intergenic
1068408019 10:56618349-56618371 ACTGGGTAACATTTTTTTTCAGG - Intergenic
1069079558 10:64073647-64073669 CCTGTGGAGCATTTTTTTTTTGG - Intergenic
1072557549 10:96533042-96533064 TCTCTTTACCATTTTTTCTCCGG + Exonic
1072579937 10:96731904-96731926 TATGATTTGCATTTTTTTTCTGG + Intergenic
1073626748 10:105105889-105105911 CATCTTTAGGATTCTTTTTCTGG + Intronic
1073914431 10:108385876-108385898 AATGTTTGACATTTTTTTTCTGG + Intergenic
1074364383 10:112846157-112846179 CCTGTTCACCATTTATTTTGGGG + Intergenic
1078648946 11:13169253-13169275 CATGCTTATCATTTTTTTTGTGG - Intergenic
1078792687 11:14560273-14560295 CCTGGTTAGACTCTTTTTTCTGG + Intronic
1078857431 11:15217687-15217709 CCTGTTTAGCATCTTTTCATAGG - Intronic
1079561183 11:21821699-21821721 CCTCTTTAGTATTTTTTGTAAGG - Intergenic
1079665780 11:23103858-23103880 CCTGTTTATCCTTTGTTTTCTGG - Intergenic
1080257059 11:30302278-30302300 CCAGTTTAGCATTTTAATTGAGG + Intergenic
1082566936 11:54692378-54692400 CCTGTTCAGTATTTTGTTACAGG + Intergenic
1082727530 11:56754226-56754248 CCTTTTTAGTATTTTTTGCCTGG + Intergenic
1084700321 11:70782571-70782593 CGTGGTTTGCCTTTTTTTTCTGG - Intronic
1085383168 11:76139003-76139025 CCTGTTTTGTTTTGTTTTTCTGG + Intronic
1085870640 11:80345581-80345603 CATGTTAAGCATTTGTTGTCTGG - Intergenic
1086789003 11:91010866-91010888 CATGTTTAGCATTTTTAGTATGG - Intergenic
1086789867 11:91023165-91023187 CCTGTCTAGCATGTTCTTCCAGG - Intergenic
1087207034 11:95407532-95407554 CCTGTTCAGCATTTTTTCTTTGG + Intergenic
1087500167 11:98941536-98941558 TCTGTGGGGCATTTTTTTTCTGG - Intergenic
1088734508 11:112717492-112717514 CCTGTTTTGCTTTGTTTTACAGG + Intergenic
1088903549 11:114136966-114136988 TCTATATAGCATTTCTTTTCTGG + Intronic
1088928377 11:114325015-114325037 CATGTTAAACATTTTCTTTCAGG - Intergenic
1091191780 11:133701667-133701689 CCAGCTTAGCTTTTGTTTTCTGG + Intergenic
1091480368 12:822915-822937 TCTCTTTAGCATTTCTTTTAGGG + Intronic
1091558221 12:1592274-1592296 CCTGTTTAAAAATTTTTTTTTGG - Intronic
1091956153 12:4645259-4645281 CCTGTTGACCATTCATTTTCTGG - Intronic
1093201203 12:16188314-16188336 TCTGTTTAGCAATTGTTTCCTGG - Intergenic
1095176401 12:39096622-39096644 CCTTTTGAGTGTTTTTTTTCTGG - Intergenic
1096612130 12:52809115-52809137 GCTGTCTAGCATTTTTTTTCTGG - Intronic
1097558359 12:61168374-61168396 CATGTTTTGTATTTTGTTTCAGG - Intergenic
1097911721 12:64977528-64977550 CCTTGTTATCATTTTTTTTGCGG + Intergenic
1098277176 12:68824814-68824836 CTTATTTAGCAATATTTTTCTGG + Intronic
1099351255 12:81571777-81571799 ACTGTTTTTCACTTTTTTTCTGG + Intronic
1099816420 12:87654510-87654532 CCTGTTTTAAATTATTTTTCCGG + Intergenic
1100917975 12:99448574-99448596 CATACTTAGCATTTTTTTTGTGG - Intronic
1101547890 12:105733898-105733920 GCTGTTAAGTATTTCTTTTCTGG + Intergenic
1101583698 12:106066564-106066586 CCTGTTTGGCATTTGCTTTATGG - Exonic
1103247923 12:119474079-119474101 GATGTTGAGCACTTTTTTTCGGG - Intronic
1105656837 13:22450939-22450961 CTTTTTTAGGATTCTTTTTCTGG - Intergenic
1105871368 13:24508474-24508496 CTTGTTTTGCATTTTTCTTCTGG + Intronic
1105906989 13:24821804-24821826 TTTGATTTGCATTTTTTTTCTGG + Intronic
1105959694 13:25320509-25320531 CATGTTTTGCATTTTTCTTAGGG + Exonic
1106855225 13:33844425-33844447 CCGTTTTATCATTTGTTTTCTGG + Intronic
1107390544 13:39958540-39958562 CCTGATAATCATTTTATTTCAGG + Intergenic
1107737118 13:43411157-43411179 CATTTTTATCATTGTTTTTCAGG + Intronic
1108169721 13:47728583-47728605 CCTGTTTCCCATTTTTATTGTGG + Intergenic
1108950776 13:56089040-56089062 CCTTTTTAGCTTTTTGTTTTTGG + Intergenic
1109327522 13:60886433-60886455 CCTGTGATCCATTTTTTTTCTGG - Intergenic
1109517671 13:63465059-63465081 CCTGTTTTGAATTATTTATCAGG - Intergenic
1109691979 13:65906709-65906731 CCTGTCTAGCATATTTTTGAGGG + Intergenic
1110051597 13:70909106-70909128 CCTGATTAGCATTGTTTAACAGG - Intergenic
1110103493 13:71639602-71639624 CAGATTTAGCATTCTTTTTCTGG + Intronic
1110142267 13:72145049-72145071 CCAGTTTTTCTTTTTTTTTCTGG - Intergenic
1110247079 13:73338726-73338748 TCTATTTAAAATTTTTTTTCTGG + Intergenic
1111422680 13:88036203-88036225 GCTTTTTACCAATTTTTTTCAGG - Intergenic
1115526612 14:34286802-34286824 TCTATTAAGCATTTTTATTCTGG - Intronic
1116669228 14:47819503-47819525 CCATTTTATCATTTGTTTTCTGG + Intergenic
1116669250 14:47820040-47820062 TCTCTTTAGCATTTCTTTTGGGG + Intergenic
1116706526 14:48309309-48309331 CCTTTTTGTCAGTTTTTTTCTGG - Intergenic
1116782247 14:49249574-49249596 CCTGTTTAGCTGTGTGTTTCTGG - Intergenic
1116850148 14:49900759-49900781 CCTGGTTAGTTTTTTTTTTTTGG + Intergenic
1116970404 14:51058921-51058943 AATGTTTTGCATTTTTCTTCAGG + Intronic
1116989340 14:51258134-51258156 CCAGTTTATCATTTTTTTTGTGG + Intergenic
1117701072 14:58414163-58414185 CCAGTTTATCATTTTTGTTTTGG - Intronic
1118054047 14:62059523-62059545 CCAACTTAGCAATTTTTTTCTGG + Intronic
1120572041 14:86130911-86130933 TCTGTTTAGCAGTCTTTTCCTGG - Intergenic
1121540741 14:94724239-94724261 CCTCTTTATAATTTTTTTTTAGG + Intergenic
1121745668 14:96288804-96288826 CCTGTTTTTTTTTTTTTTTCTGG - Intronic
1123191644 14:106577797-106577819 TCTGTTCAGTTTTTTTTTTCGGG + Intergenic
1124593055 15:31070226-31070248 CCTGCTTTGCCTTTGTTTTCAGG - Exonic
1125481002 15:40080641-40080663 TCTGTCTACCATTTCTTTTCTGG + Intergenic
1125901914 15:43356504-43356526 CCTGTATAGCACTATTTTTACGG - Intergenic
1125918890 15:43512698-43512720 CTTGTTTAGCATTTTTATTTAGG + Intronic
1126432019 15:48596411-48596433 CTTCATTAGCATTTATTTTCAGG - Intronic
1127198723 15:56619770-56619792 TGTTTTTAGCATTTGTTTTCTGG + Intergenic
1127202212 15:56667348-56667370 CCTTTCTAGAATTATTTTTCAGG - Intronic
1128044332 15:64604239-64604261 CCTAGTAAGCATTCTTTTTCTGG - Intronic
1128691839 15:69730563-69730585 CCTGTTCAGCATTCATGTTCTGG - Intergenic
1128964308 15:72042465-72042487 CTTGTTTAGAGCTTTTTTTCAGG - Intronic
1129935700 15:79448320-79448342 CCTCTTTAGCAATTTTTTTGTGG + Intronic
1130290854 15:82599432-82599454 TATTGTTAGCATTTTTTTTCAGG - Intronic
1130372965 15:83302636-83302658 CACGCTTAGTATTTTTTTTCAGG - Intergenic
1131698399 15:94905194-94905216 CCTGTTTATCCTATTTTCTCTGG - Intergenic
1133102408 16:3487385-3487407 CCAGTTTCACATTCTTTTTCTGG - Intergenic
1133949214 16:10376189-10376211 TCTTTTTAGCATTTTTTGTAGGG + Intronic
1137379996 16:47988861-47988883 GTTGGTGAGCATTTTTTTTCAGG - Intergenic
1137449503 16:48557644-48557666 CCAGTTTAGGATTTTTTTAGTGG - Intronic
1137945257 16:52727930-52727952 TCTGTTTACCATTTTTTCTGAGG - Intergenic
1138834721 16:60420369-60420391 TCTCTTTAGCATTTTGTCTCCGG - Intergenic
1139043281 16:63026672-63026694 CCTCTTTAGAATTTTCTTCCAGG - Intergenic
1142831540 17:2552826-2552848 CCTTTTTAGCTATTTTTTTCTGG - Intergenic
1145360320 17:22206735-22206757 CCTGTTTAATTTTTTTTTTCAGG + Intergenic
1145826647 17:27882066-27882088 TCTTTACAGCATTTTTTTTCTGG + Intronic
1146261336 17:31423855-31423877 CCTTTTTCTCATTTTTTTCCAGG + Intronic
1146290567 17:31603558-31603580 CCAGTTCAGCAGTTTCTTTCTGG + Intergenic
1148009444 17:44464196-44464218 CCTGTTTTAAATTTTTTTTTTGG - Intronic
1148295374 17:46497325-46497347 CCTTTTTATTATTTGTTTTCTGG + Intergenic
1148614703 17:48991791-48991813 CCTGTTTAGGATTTTTTTTCAGG - Intergenic
1148671136 17:49411135-49411157 ACTGTTTTGCAGTTGTTTTCAGG - Intronic
1149192682 17:54082888-54082910 TCTGTGTAGCTTATTTTTTCTGG + Intergenic
1149862427 17:60129784-60129806 CATGTTCAGCCTTTTTTTTTTGG - Intergenic
1150384425 17:64747078-64747100 CTTGTTTTGTATTTTTTCTCTGG - Intergenic
1150407224 17:64912612-64912634 CCTTTTTATTATTTGTTTTCTGG - Intronic
1151060892 17:71092744-71092766 CATTTTTGGCTTTTTTTTTCTGG + Intergenic
1151080132 17:71320068-71320090 CTTATTTAACATTTTTTATCAGG + Intergenic
1153856919 18:9158941-9158963 TCTGTTTTTCAATTTTTTTCTGG + Intronic
1153976409 18:10271903-10271925 GCTGTTTAGCCTTTCTTTTTGGG + Intergenic
1156600988 18:38606516-38606538 ACTGTTTAACATCTTTTTTGAGG - Intergenic
1157878582 18:51296710-51296732 CCTCTTAAGCTTTTGTTTTCTGG - Intergenic
1158771785 18:60526940-60526962 CTTCTGTAGCATTTTATTTCAGG - Intergenic
1159000086 18:62965799-62965821 CATTCTTAGCATTTCTTTTCTGG - Intronic
1160459633 18:79028596-79028618 CCTGAAGAACATTTTTTTTCTGG - Intergenic
1160614654 18:80115771-80115793 ACTGTTGTGCTTTTTTTTTCTGG + Intronic
1161539470 19:4841353-4841375 CCTGTTTGGCCTTTTGTGTCCGG - Intronic
1163644684 19:18482115-18482137 CATGTTGAGCATCTTTTTACAGG + Intronic
1164122054 19:22274826-22274848 CCTATTTATCATTTTTTATTGGG - Intergenic
1165403476 19:35616477-35616499 CCTGTTAACCATTGTTATTCTGG + Intronic
1165645679 19:37433838-37433860 TCTCTTTAGCATTTTTTTGTAGG - Intronic
1165668005 19:37650439-37650461 GCTGTTTTGAATTTTTGTTCAGG - Intronic
1165703966 19:37961689-37961711 CTTGTTCAGATTTTTTTTTCTGG + Intronic
1166946367 19:46399345-46399367 CCTGGTTGGCATTGATTTTCTGG - Intergenic
1167652162 19:50737944-50737966 CGTGTTTAGGATTTTTTCTTTGG + Intergenic
1167734661 19:51286205-51286227 GCTGTTTAGAATTGGTTTTCTGG + Intergenic
1168079240 19:53997419-53997441 CCTGTTTTGTTTTTTTTTTCTGG + Intronic
925737010 2:6972434-6972456 CCTTTTTAGAATAATTTTTCAGG + Intronic
926662808 2:15486837-15486859 ACTGGTTAGCATTTTTTTTTTGG - Intronic
927411015 2:22826475-22826497 CATGTTAAGCATTTATTTTGTGG + Intergenic
927429173 2:23012424-23012446 GCTGTTTTACATTTTCTTTCAGG + Intergenic
927505617 2:23611953-23611975 CTTTTTTTGCATTTTTTCTCTGG - Intronic
928355555 2:30611116-30611138 ACTCATTAGCATTTTTCTTCTGG + Intronic
928698087 2:33870947-33870969 CCTGTTTGTCATTGGTTTTCAGG + Intergenic
928814081 2:35268658-35268680 CCTGTTTTCAATTTGTTTTCTGG + Intergenic
929483137 2:42331305-42331327 GCTGTGTAGCAGTTTTTTTCTGG + Exonic
929490768 2:42394251-42394273 CCTTTTTAGCAGTTTTTGTTGGG - Intronic
929708084 2:44237231-44237253 CTTGTTTAGCATTTTCTTTAGGG - Intronic
930246909 2:48992978-48993000 ATCATTTAGCATTTTTTTTCCGG + Intronic
930543724 2:52740734-52740756 CCTGTTTAGAATTATTTTCTGGG + Intergenic
930714254 2:54577788-54577810 CCTGTTGAGCATTTTTCACCTGG + Intronic
930740806 2:54831019-54831041 TCTGTTTGGCATGTTTTTTCCGG - Intronic
930899067 2:56481713-56481735 TATGTTTACCCTTTTTTTTCTGG + Intergenic
931103900 2:59033142-59033164 CCATTATAGCATATTTTTTCTGG + Intergenic
931288544 2:60852852-60852874 ACTGTTTAGCAATTTTGGTCAGG - Intergenic
931523920 2:63131721-63131743 CCTCTTTAGCATTTCTTGTAGGG + Intronic
933451871 2:82464056-82464078 CATTTTCAGCATTTTTTTTTAGG - Intergenic
934966308 2:98726742-98726764 GCTGTTTTGTATTTTTTTCCAGG - Intronic
935082586 2:99813033-99813055 CCTGATTATCTTTTTTTTTTTGG - Intronic
935877405 2:107525307-107525329 TCTGTGCAGAATTTTTTTTCTGG + Intergenic
936952746 2:117994567-117994589 CCAGTTTGGAATTCTTTTTCTGG + Intronic
937432076 2:121847294-121847316 CATGCTTATCATTTTTTTTTGGG + Intergenic
937582792 2:123508870-123508892 TCTGTTGTGCATTTTTTTTTTGG - Intergenic
937725857 2:125165736-125165758 CATGTTGAGTATTTTTCTTCTGG - Intergenic
939800890 2:146706565-146706587 CCTCACTAGCATTTTTTTTATGG - Intergenic
939845289 2:147236702-147236724 ACTGTTTGGCATTTTTTTACAGG - Intergenic
940529438 2:154861930-154861952 CTTTTTTTACATTTTTTTTCTGG + Intergenic
940725817 2:157334989-157335011 CCTGAAGAGCATTTCTTTTCTGG - Intergenic
941362785 2:164573063-164573085 CCTGTTTTGTAATTTTTTTTAGG + Intronic
941829631 2:169940630-169940652 ACTGTTTACCAATGTTTTTCTGG + Intronic
943704062 2:191016310-191016332 CATGTTAAAAATTTTTTTTCTGG + Intronic
943914702 2:193615246-193615268 CTTGTTTAACATTATTTTTATGG + Intergenic
944370439 2:198976063-198976085 CCTCTTTAGCATTTCTTGTAGGG - Intergenic
944642573 2:201743248-201743270 CCTATTTCAAATTTTTTTTCTGG - Intronic
944827378 2:203498710-203498732 CCAGTATGGCATTTTTTTTATGG - Intronic
945762113 2:213926490-213926512 CATGTTTTTCATTTTTTTTCCGG + Intronic
946152107 2:217782840-217782862 CTTTTTTAGTTTTTTTTTTCTGG - Intergenic
946635886 2:221724972-221724994 TCTCTTTAGCATTTTTTATAAGG - Intergenic
947206069 2:227662340-227662362 CCTTTTCAGGATTTTTTTTTGGG + Intergenic
1169876221 20:10299785-10299807 CTTGTTTAGCATTTTATCTGTGG - Intronic
1171312051 20:24152441-24152463 GGTGTTTAGTTTTTTTTTTCTGG - Intergenic
1172172316 20:32945530-32945552 CTTGTTGAGCATTTTTATTACGG + Intronic
1172968693 20:38857911-38857933 CCAGTCTATAATTTTTTTTCTGG - Intronic
1173466255 20:43284024-43284046 CTGGTTTAGTAATTTTTTTCTGG - Intergenic
1174563469 20:51447608-51447630 CCTGTTTTGCAATGTTTTGCTGG + Intronic
1177983119 21:27940282-27940304 CCTTTTTAATTTTTTTTTTCAGG - Intergenic
1178700036 21:34825568-34825590 CCTGTCTACCATGTTTGTTCTGG + Intronic
1179023390 21:37659172-37659194 CCTGTTTTTCTTTTTTTTCCAGG + Intronic
1179498239 21:41789032-41789054 ACTGTTAACCATGTTTTTTCTGG - Intergenic
1182163660 22:28149902-28149924 CCTACTTACCATTTTTTTGCTGG - Intronic
1183167808 22:36160835-36160857 CCTGTTTTGCATGTTTGATCAGG - Exonic
949989358 3:9565707-9565729 CCCATTTAGCATTTTTCTCCTGG + Intergenic
950880209 3:16317194-16317216 CCTGTTGTGCATTTCTTCTCTGG + Exonic
951312704 3:21148401-21148423 CCTCTTGAGGACTTTTTTTCTGG + Intergenic
951405838 3:22296413-22296435 CCATTTTAGCATTTTCTTCCTGG - Intronic
951900591 3:27654193-27654215 CCAGTTTATCAGATTTTTTCTGG - Intergenic
951993460 3:28701480-28701502 GTTGTTTAGCAGTTTTGTTCAGG + Intergenic
952949585 3:38510320-38510342 CCTTTTTAGCAACTTTTTTCTGG - Intronic
952954292 3:38547496-38547518 CCTTTTTAGGAATTTTTTTCAGG - Intergenic
953048970 3:39323130-39323152 CTTGTTTACCATATTTTTCCTGG - Intergenic
953101620 3:39835279-39835301 CCTGTTTATTATTTTTCTTAAGG + Intronic
953350760 3:42214107-42214129 CTTGTTGAGCATTTTCTCTCTGG + Intronic
953836109 3:46345821-46345843 TATGTTTAGCATTTTTTTTTAGG + Intergenic
954271144 3:49510397-49510419 CCTGCTTTTCTTTTTTTTTCAGG + Exonic
954428577 3:50456945-50456967 CCAGTTTATCATTTTATTTGGGG - Intronic
955331778 3:58053185-58053207 CCTGTTTATCACATTTTTTAAGG - Intronic
955847177 3:63178390-63178412 ACTCTTTTGCATTTTCTTTCTGG - Intergenic
957176936 3:76823880-76823902 CCTGATTAGCAGTTGTTTTATGG + Intronic
957568950 3:81921103-81921125 CATTTTTAAAATTTTTTTTCTGG - Intergenic
957608892 3:82441702-82441724 CTTGTTTAGCATTGTATTTCCGG + Intergenic
957652618 3:83028408-83028430 CATTTTTAGCATAGTTTTTCAGG - Intergenic
958023123 3:88020223-88020245 CCAACTTAGCATTTTTTTTGTGG - Intergenic
958459678 3:94379105-94379127 CCTGTTTTACATATTTTGTCTGG - Intergenic
958837684 3:99164799-99164821 TCTCTTTAGCATTTTTTTGTTGG - Intergenic
959182193 3:102995506-102995528 GCTGTGTGGCTTTTTTTTTCTGG - Intergenic
959286202 3:104414412-104414434 TCTGTATATCATTTTATTTCTGG - Intergenic
959322250 3:104891699-104891721 TCTGTTTAGAATTTTTATTTGGG - Intergenic
959589994 3:108068537-108068559 CCCGTTTTGCATTTATTTTGAGG - Intronic
959646226 3:108705293-108705315 CATTTTTTGCATTTTTTTTTTGG - Intergenic
959838249 3:110945466-110945488 CATTTTTAGGATTTTTTTTTTGG - Intergenic
960242559 3:115362534-115362556 CCTGGTTAGCTTTTTTTATTTGG - Intergenic
960468472 3:118029215-118029237 CCTTTTTAGCATTTCTTCTAGGG + Intergenic
960723358 3:120646096-120646118 TCTGTTTTGCATATATTTTCTGG + Intronic
962008733 3:131372869-131372891 CTTGTTTTGCACTTTTTCTCTGG - Intergenic
962010776 3:131388214-131388236 CTTGTTTTGCACTTTTTCTCTGG - Intronic
963224767 3:142851086-142851108 CATATATAGAATTTTTTTTCTGG + Intronic
963371831 3:144411310-144411332 TCTGTTTAGTTTTTTTTTTATGG + Intergenic
964314224 3:155426216-155426238 CCTGTTTTCCATGCTTTTTCTGG + Intronic
964665696 3:159169631-159169653 CCTCTTTTTCATTTTTATTCTGG - Intronic
965022218 3:163246531-163246553 TCTGTTTAGCATATTTCTTCTGG + Intergenic
965482854 3:169241727-169241749 CCTGTTCAACATTTCTTTCCTGG - Intronic
966115005 3:176451018-176451040 CCCCTTTATCATTTTTTTTTTGG + Intergenic
967119981 3:186374171-186374193 CCAGTTTGACATTTTTTTCCTGG - Intergenic
967130261 3:186464375-186464397 CCTCTTTACCATTGTTTTTTGGG - Intergenic
970205995 4:13655950-13655972 CCTGCTTATTTTTTTTTTTCTGG - Intergenic
970243410 4:14032878-14032900 CATGTTTAGAATTCTTTTCCTGG + Intergenic
971465385 4:26953158-26953180 CCTGTTATGTATTTTGTTTCAGG + Intronic
971485411 4:27155291-27155313 CCTGTTTTGCATTTGATTTGGGG - Intergenic
971628526 4:28957671-28957693 CGTGTGTAGCATTTTGTGTCTGG + Intergenic
972322217 4:37982527-37982549 CCTGTGGAGCACTTTTTATCTGG + Intronic
972330383 4:38058602-38058624 CCTGTTTTACATTTATATTCTGG + Intronic
972621958 4:40755959-40755981 TTTGTTTAGCATTTTTATTGGGG + Intronic
972826678 4:42767478-42767500 CCTGTTGAGGATGTGTTTTCGGG - Intergenic
973576492 4:52294996-52295018 ACTTTTTAGCTTTTTTTTTTTGG + Intergenic
973629405 4:52805282-52805304 CCTCTTTATCATTTTTTATTGGG - Intergenic
974073518 4:57147444-57147466 CCTCTTTATCATCTCTTTTCAGG - Intergenic
974492650 4:62587278-62587300 ATTCTTTAGCATTTTTTTTTTGG + Intergenic
974506003 4:62772795-62772817 TATGTCTACCATTTTTTTTCTGG - Intergenic
974977091 4:68905139-68905161 CCTGTTTAGCAGCTTATTGCAGG - Intergenic
975146561 4:70973819-70973841 CTTGTTTAGTATTATTGTTCAGG + Intronic
975713260 4:77181331-77181353 CTTTTTTAGCAATTTTTTGCAGG + Intronic
976574383 4:86652416-86652438 TCTCTTTAGCATTTTTTGTAAGG + Intronic
977084654 4:92577581-92577603 ACTGTTTGGCATTGTTTTTGAGG + Intronic
977100146 4:92800962-92800984 CGTGTTTATCATTATGTTTCCGG - Intronic
977422059 4:96813469-96813491 CCTGTTTGCCAATTTTTTTGGGG + Intergenic
978221247 4:106277372-106277394 CCTGTTAAGTCTTTTTTTTGTGG - Intronic
978386056 4:108176333-108176355 CCTGTGTAGGATGTGTTTTCTGG - Intergenic
978970668 4:114800511-114800533 ATTTTTTAGCATTTTTTATCTGG + Intergenic
979371169 4:119888209-119888231 CCTGTTCAACATTTTTCTTGAGG - Intergenic
980239610 4:130156575-130156597 CCTGTTTAGGATTTTTTAAATGG + Intergenic
980437501 4:132797439-132797461 TCTGATTAGCACTTTTTTTCAGG - Intergenic
980455499 4:133035918-133035940 CATGTTATGCATTTTTTTTGTGG - Intergenic
981164492 4:141541304-141541326 CCTGTTATTCATTTTTTTTAAGG + Intergenic
981169725 4:141606971-141606993 TCTGTTTTCCAGTTTTTTTCTGG + Intergenic
981169817 4:141608802-141608824 TCTGTTTTCCAGTTTTTTTCTGG + Intergenic
981449390 4:144878930-144878952 TCTGTTAAGGATTTTTTTTGGGG - Intergenic
982674041 4:158355330-158355352 CCTGTTTAGCACTTTTTGCCAGG + Intronic
982790031 4:159580636-159580658 TCTTTATAACATTTTTTTTCTGG + Intergenic
983017433 4:162630318-162630340 TCTCTTTAGCATTTTTTTGTAGG - Intergenic
983092452 4:163521018-163521040 CCTGTTGAACATGTTCTTTCTGG + Intergenic
983221385 4:165047361-165047383 CCATTTTTGCATTTTTTTTAAGG + Intergenic
984223991 4:177013294-177013316 ACTATTTTGTATTTTTTTTCAGG + Intergenic
984576895 4:181461161-181461183 TTTGTTTATCTTTTTTTTTCTGG + Intergenic
987355158 5:17057278-17057300 TCAGTTTTGCATTTTTTTTCAGG + Intergenic
988000334 5:25339895-25339917 CATCTTTAGCATTTCTTCTCTGG - Intergenic
988273095 5:29042658-29042680 ACTATTTAGCTTTTTCTTTCAGG + Intergenic
988299139 5:29400316-29400338 CTTTTTTTTCATTTTTTTTCAGG - Intergenic
988788693 5:34587445-34587467 CTTGTTTAGATTTCTTTTTCGGG + Intergenic
988993960 5:36696698-36696720 CCTTTCTATCATTTTTTGTCTGG + Intergenic
989685117 5:44076377-44076399 CCAATTTAACTTTTTTTTTCTGG + Intergenic
990166471 5:52999220-52999242 CCTATTTATCATTGTATTTCAGG + Intronic
990264856 5:54063949-54063971 CATTTTTAGCATTTTTCTTAGGG + Intronic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
991005050 5:61820602-61820624 ATTTTTTAGCATTTTTTTCCAGG - Intergenic
991461138 5:66860601-66860623 CCTTTTTCGTTTTTTTTTTCTGG + Intronic
993687448 5:90957009-90957031 CATGTTTACTTTTTTTTTTCTGG - Intronic
993971100 5:94421051-94421073 CCTTTTTGGCATATCTTTTCTGG + Intronic
994155285 5:96496827-96496849 ACTGTTTTGCTTTTTTTTTAGGG + Intergenic
994354986 5:98784771-98784793 AGTGTTTATCATTATTTTTCTGG + Intronic
994389812 5:99178619-99178641 CCTCTATCCCATTTTTTTTCTGG - Intergenic
994499680 5:100559044-100559066 ACAGTTTAGCATGTTTTTGCAGG + Intronic
995222415 5:109665042-109665064 ATTGTTTAGCATTTATATTCTGG + Intergenic
995339064 5:111036202-111036224 CCTTTTTAGCAGTTTTATTGAGG + Intergenic
996530254 5:124520938-124520960 GCTATATACCATTTTTTTTCTGG - Intergenic
997068464 5:130590757-130590779 CATGCTTAGAATTCTTTTTCAGG - Intergenic
998546878 5:143036393-143036415 GCTGTTGATCATTTATTTTCTGG + Intronic
999132358 5:149294106-149294128 CCTCTGTAGCATATTTTTTCTGG + Intronic
999828943 5:155300644-155300666 ACTGCTGAGCATTTTTTTTTAGG + Intergenic
1000472445 5:161661864-161661886 CCTTTTTACCATTTTTTCTTGGG - Intronic
1000487967 5:161871733-161871755 CCTGGTTAGGATTTTGTGTCTGG - Intronic
1000755575 5:165155065-165155087 GATGTTTAGTATTTTTTTTTTGG - Intergenic
1004694140 6:18018449-18018471 CCTATTTTGCTTTTTTTTTTTGG - Intergenic
1005192154 6:23236813-23236835 CCTTTTTATGATTTCTTTTCTGG + Intergenic
1005203885 6:23378905-23378927 CCTGTTTATCATTTATTTAAGGG - Intergenic
1006525561 6:34601845-34601867 CCTGTAGAGCATTTTGTATCTGG - Intronic
1007057197 6:38898523-38898545 CCTATTAAGCCTTTATTTTCTGG - Intronic
1007370591 6:41424512-41424534 CCAGTCTAGCATTTCTTTGCAGG + Intergenic
1008058767 6:46974493-46974515 CCTGTGTAGGCTTTTTATTCTGG - Intergenic
1009036772 6:58126581-58126603 TTTAATTAGCATTTTTTTTCAGG + Intergenic
1009856794 6:69274939-69274961 CCTGTTTAGGATTTTTCATTTGG + Intronic
1013020048 6:106205574-106205596 CCTGTTTAGCATTTTTTTTCAGG - Intronic
1014008069 6:116443948-116443970 GCTGTTTACCATTTTTGTCCAGG + Intergenic
1014708633 6:124779767-124779789 TCTGGGTAGCACTTTTTTTCTGG - Intronic
1015036165 6:128657220-128657242 CCTAATTAGCATTATTTTCCTGG + Intergenic
1016276375 6:142358146-142358168 AGTGTTTAGCAGTATTTTTCTGG + Intronic
1016706639 6:147116520-147116542 CCTGTTTCTCCTTTGTTTTCTGG + Intergenic
1017303808 6:152893246-152893268 ACTGTTTAGCATATATTTGCTGG - Intergenic
1017703498 6:157098259-157098281 GCTGTTCAGCATTTTATGTCTGG + Intronic
1018090476 6:160342680-160342702 CCTATTTAGCATTTTCTTTTTGG + Intergenic
1020583792 7:10039063-10039085 CTTATTTAGCTTTTTTTTCCAGG + Intergenic
1020657510 7:10944992-10945014 CCATTTTGGGATTTTTTTTCGGG - Intergenic
1020891679 7:13886019-13886041 CCTGTTTGGGATATTTGTTCTGG + Intergenic
1021042043 7:15874022-15874044 CATGTTGAGCCTTTTTTTTTAGG + Intergenic
1021232310 7:18100857-18100879 CTTCTTGAGTATTTTTTTTCTGG + Intronic
1021596902 7:22326877-22326899 CCTCTTTAATATTTTTTTTGTGG - Intronic
1023272901 7:38484576-38484598 TCTGTTTAGCATTTTTTATAAGG - Intronic
1024261124 7:47574495-47574517 CCTGCTTTCCATTTTTTTTTTGG - Intronic
1024951742 7:54868388-54868410 CCTTTTCATAATTTTTTTTCTGG + Intergenic
1026515311 7:71064723-71064745 CCTAGTTAGCCTTTTGTTTCTGG - Intergenic
1026777678 7:73240908-73240930 CCTTTATAGCATTTTTCTCCTGG - Intergenic
1027018531 7:74794280-74794302 CCTTTATAGCATTTTTCTCCTGG - Intergenic
1027069496 7:75151638-75151660 CCTTTATAGCATTTTTCTCCTGG + Intergenic
1027498635 7:78920771-78920793 TCTGTTCAGCATTTTATTTTAGG - Intronic
1027582334 7:80014201-80014223 TCTTTTTAGCATTTTTTGTAAGG + Intergenic
1027842294 7:83328518-83328540 TCTGTTTTGCATTTTATTTAAGG - Intergenic
1028883262 7:95904051-95904073 CCAGTTTTGCCTTATTTTTCTGG + Intronic
1030406962 7:109127277-109127299 CTTGTTTACCATATTTTTCCTGG - Intergenic
1030534687 7:110751284-110751306 TCTTTTTAAAATTTTTTTTCTGG - Intronic
1030762249 7:113366037-113366059 CTTGTTTAGCATATTTGTCCAGG - Intergenic
1030773323 7:113502027-113502049 CATGTTTTGCATATTTTTTCAGG - Intergenic
1030918265 7:115345199-115345221 ACTGTTTAGCATTTTTTTTTTGG - Intergenic
1031610153 7:123816868-123816890 CCTGTTTGGTATTTGCTTTCAGG + Intergenic
1031673026 7:124574969-124574991 CCTGTTTACCATTCTATTTCTGG + Intergenic
1032929097 7:136645101-136645123 CTTCTTTATCATTTATTTTCAGG - Intergenic
1033289038 7:140065787-140065809 CCTTTTCAGGATTTTTTTCCAGG - Intergenic
1033774335 7:144590591-144590613 CCAGTTTTGCATTTTTTTCCTGG - Intronic
1034050949 7:147983984-147984006 CCTGCTAAGCAGTTTTTTTGTGG - Intronic
1034479013 7:151305518-151305540 CCTCTCAAGCATCTTTTTTCAGG - Intergenic
1034581428 7:152046824-152046846 CCTTTTTATTATTTGTTTTCTGG + Intronic
1035350723 7:158244337-158244359 CTTGTTCAGCCTTTTTCTTCAGG - Intronic
1035546932 8:488946-488968 GCAGTTAAGCATTTTTTTTTTGG + Intergenic
1035879698 8:3232254-3232276 CCAGTTAAGCATTTGATTTCAGG - Intronic
1036737775 8:11333487-11333509 CCCCTTTAGCATTTCTTGTCAGG - Intergenic
1036764528 8:11539433-11539455 TCTGTTTGGGATTTTTTTTCGGG + Intronic
1036926986 8:12916439-12916461 CCTGTTTAGCTTTCTGTTTCAGG + Intergenic
1037105223 8:15098647-15098669 CCTGTTCTGCCTTTTTTTTCTGG + Intronic
1037488677 8:19375750-19375772 AATACTTAGCATTTTTTTTCTGG - Intronic
1038303612 8:26378917-26378939 CCTGTTTTGCTTTGTTTTACAGG + Intergenic
1038891481 8:31729605-31729627 ACTCTTCAGAATTTTTTTTCTGG - Intronic
1039119245 8:34127535-34127557 ACTGTTTACAATCTTTTTTCAGG - Intergenic
1040606367 8:48936098-48936120 CCTATTTACCATTATTTTTGTGG + Intergenic
1042219318 8:66458071-66458093 CCTGAATATCATTTTATTTCTGG - Intronic
1042480981 8:69302063-69302085 ACTTTTTAACATTTTATTTCTGG + Intergenic
1043041736 8:75272394-75272416 TCTCTTTAGCATTTTTTTGCAGG - Intergenic
1043103106 8:76071897-76071919 TCTTTTTAACAATTTTTTTCTGG - Intergenic
1044402357 8:91787734-91787756 GCTTGTTTGCATTTTTTTTCAGG + Intergenic
1044978170 8:97687395-97687417 ACTGAATAACATTTTTTTTCTGG + Intronic
1045544185 8:103113160-103113182 CCTGTTGATCCTTTTATTTCTGG - Intergenic
1046312475 8:112456112-112456134 CCTTTTCCACATTTTTTTTCCGG - Intronic
1046327810 8:112672909-112672931 ACTCCTTAGCATTTTTATTCAGG - Intronic
1046733053 8:117746571-117746593 GCTGTTTATCTTTTTCTTTCTGG - Intergenic
1047935638 8:129775513-129775535 CCTAGTTATCATTTTTTTTGTGG - Intronic
1048083703 8:131155789-131155811 CCTGCTCAGGATTTTTTTTATGG + Intergenic
1049937022 9:509096-509118 CCTATTTATTATTTTTTTTTTGG + Intronic
1050161201 9:2719973-2719995 CCTGATTAACATTTATTTCCAGG - Intronic
1050786611 9:9411654-9411676 CCTGTTTAGGTCCTTTTTTCAGG - Intronic
1052063548 9:23989472-23989494 CCATTTTATGATTTTTTTTCTGG - Intergenic
1052571353 9:30228178-30228200 CCTATTCAACTTTTTTTTTCTGG - Intergenic
1053090699 9:35273709-35273731 CCTGCCTAGCGTTTTTTTTGTGG - Intronic
1055786146 9:79870960-79870982 CCTATTTATCATATTTTTACAGG - Intergenic
1055808753 9:80126466-80126488 GCTGTTTAGTTTTGTTTTTCTGG - Intergenic
1055826564 9:80333150-80333172 CATTTTTGTCATTTTTTTTCTGG - Intergenic
1056333296 9:85539951-85539973 CTGGCTCAGCATTTTTTTTCTGG + Intergenic
1056822071 9:89850200-89850222 CCTGTTTGACATTCTTTTTTTGG - Intergenic
1057071235 9:92102262-92102284 CTTGTTAAGCATTTCTTGTCAGG - Intronic
1057091602 9:92263055-92263077 ACTGTTTGGGGTTTTTTTTCAGG - Exonic
1058698283 9:107578429-107578451 GCTGTTTATCTTTTTTTTTTAGG + Intergenic
1059555177 9:115273473-115273495 CCATTTTATCATTTGTTTTCTGG + Intronic
1060412274 9:123407687-123407709 TCTGTTTAGCATTTTCTCCCCGG - Intronic
1186353979 X:8770866-8770888 CCTGTTAACCTTTTTTTTTCTGG + Intergenic
1187102908 X:16213161-16213183 CCTGTTTACCATGCTTTTCCTGG + Intergenic
1187502768 X:19853536-19853558 GCTGTCTACCATTTTTTTTCTGG - Intronic
1187881767 X:23853784-23853806 CCTGGTTATTATTTTTTTTTTGG + Intronic
1188003131 X:25000738-25000760 ACAGTTTCCCATTTTTTTTCAGG - Intergenic
1188255177 X:27953695-27953717 AGTGTTTAGCATTTCTTTTGTGG + Intergenic
1188344774 X:29050654-29050676 ACTGTTTGCCATTATTTTTCAGG + Intronic
1188750965 X:33905414-33905436 AGTGTTTAACATTTCTTTTCAGG - Intergenic
1189588400 X:42485635-42485657 CTTGTCAAACATTTTTTTTCTGG + Intergenic
1190249706 X:48713182-48713204 CCTGTTTGGGATATATTTTCAGG - Intergenic
1190501497 X:51083147-51083169 TCTGTTTTGTTTTTTTTTTCAGG - Intergenic
1191640038 X:63421566-63421588 TCTGTTTAGCATTTCTTGTAGGG + Intergenic
1191690105 X:63930703-63930725 ACTGTTTTGAATTGTTTTTCTGG + Intergenic
1191755469 X:64587791-64587813 CCAGTTTAGTGATTTTTTTCAGG + Intergenic
1192384042 X:70647399-70647421 CATACTTAGCATTTTTTTTGTGG - Intronic
1192503103 X:71665907-71665929 CCTGCTCAGCATTTTCTTCCCGG + Intergenic
1193388879 X:80904019-80904041 TATGTTAAGCATTTTTTTTCAGG + Intergenic
1194419102 X:93650153-93650175 CCTGTTGCTCCTTTTTTTTCGGG + Intergenic
1194497707 X:94637527-94637549 CCTCTTTATCATTTTTTATTGGG - Intergenic
1194558090 X:95387417-95387439 TCTGTTTGGCATATTTTTTGAGG + Intergenic
1194596008 X:95858972-95858994 TCTGTTTAGAATTTTTTCTTGGG + Intergenic
1194823782 X:98536651-98536673 CATGTTTTGAAGTTTTTTTCTGG - Intergenic
1195536818 X:106017720-106017742 GCTGTTTAGCATTTCTTGTATGG + Intergenic
1196360139 X:114843971-114843993 TCCCTTTAGCATTTTTTTTTAGG - Intronic
1197100436 X:122647086-122647108 ACAGTTAAACATTTTTTTTCGGG - Intergenic
1197248111 X:124187460-124187482 CCTGCTATGCATTCTTTTTCTGG + Intronic
1197371423 X:125630286-125630308 CCTTTTTAGCATTTCTTGTAGGG - Intergenic
1198584052 X:138099585-138099607 CCTCTTGAGCATTTTTTGTAGGG - Intergenic
1200393499 X:155968365-155968387 CCTGTGTAGCTTTTCTTATCTGG + Intergenic
1200500736 Y:3945837-3945859 TCTTTCTACCATTTTTTTTCAGG - Intergenic
1200944037 Y:8814402-8814424 CCAGTTTTTCAGTTTTTTTCTGG - Intergenic
1201686827 Y:16714067-16714089 CCTGTTTTACATGTTGTTTCAGG - Intergenic
1202382035 Y:24281535-24281557 TCCGTTAAGCATTTTTTTTAAGG + Intergenic
1202488749 Y:25388590-25388612 TCCGTTAAGCATTTTTTTTAAGG - Intergenic