ID: 1013020773

View in Genome Browser
Species Human (GRCh38)
Location 6:106215135-106215157
Sequence TTTTATGTAAGTACACCAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013020773 Original CRISPR TTTTATGTAAGTACACCAAA AGG (reversed) Intronic
902262113 1:15234098-15234120 TTTTAAGTAAGTAGTCCCAAAGG + Intergenic
902303119 1:15517000-15517022 ATTTATGTAAGCACTCCGAACGG + Intronic
905003466 1:34692137-34692159 TTTCATGTTACTACTCCAAAGGG + Intergenic
905591053 1:39164092-39164114 TTTTATGGAATTCCATCAAATGG + Intronic
907803263 1:57792776-57792798 TTTTATTTATGTACCCCATAGGG + Intronic
908703073 1:66923230-66923252 GTTTGTGTAAGTACACTAAATGG - Intronic
909321669 1:74296412-74296434 TTTTAAATAAATACACAAAAAGG - Intronic
909758279 1:79255604-79255626 GTTTGTGTAAGTACACCCTATGG + Intergenic
910213535 1:84818249-84818271 TTTTATGTAATTCAACGAAAAGG + Intronic
910424462 1:87105667-87105689 TTTTATGTATTTGGACCAAAAGG + Exonic
910591596 1:88932456-88932478 TTGTATATAATTACTCCAAATGG - Intergenic
912641340 1:111348659-111348681 TTTTGTTGAAGTGCACCAAAAGG - Intronic
915675067 1:157521884-157521906 TTTTATGTCAGTATCCCTAAAGG - Intronic
916780017 1:168015522-168015544 ATTTAAGTAATTAAACCAAATGG - Intronic
920548750 1:206840326-206840348 ATTGATGTAAAGACACCAAAGGG - Intronic
921764825 1:218959355-218959377 TTTTGTGTAAGTTCTCCAATTGG + Intergenic
922135364 1:222819989-222820011 TTTCATTTATGTTCACCAAAAGG + Intergenic
1064105483 10:12497637-12497659 TTTTATGTCTGTATCCCAAATGG + Intronic
1064872516 10:19954828-19954850 TCTCCTGTAAGTAGACCAAAAGG - Intronic
1066052972 10:31652604-31652626 TTTTTTGTAACTACAGAAAATGG + Intergenic
1066521697 10:36227409-36227431 TTTTATTTAAGAATACAAAAAGG - Intergenic
1068450116 10:57175313-57175335 TTTTATTAAAGTAGCCCAAAGGG + Intergenic
1068897692 10:62225652-62225674 TTTAACGTAAGTACCACAAAGGG - Intronic
1069265244 10:66449067-66449089 TTTTATATAATTACTCCAATGGG - Intronic
1071201631 10:83225908-83225930 GTTTGTGTAAGTACACAACAAGG - Intergenic
1071752800 10:88500119-88500141 ATTTATGTCAATGCACCAAACGG + Intronic
1074281654 10:112057654-112057676 GTTTATGTAAGTACACTCCATGG + Intergenic
1076279802 10:129236797-129236819 TTTTCGGTAAATACAGCAAAAGG - Intergenic
1076282455 10:129260020-129260042 TTTTATGTAGGTAAGTCAAAAGG - Intergenic
1077724156 11:4657291-4657313 TTTTATAAAAGTACACAATAAGG - Intergenic
1081622931 11:44629711-44629733 TTTTTTGTAATTACTCAAAAAGG - Intergenic
1082271412 11:50173317-50173339 ATTTGTGGAAGAACACCAAATGG - Intergenic
1084469148 11:69345289-69345311 TTTGATGTATGTAAACCACATGG + Intronic
1085483822 11:76844847-76844869 TTTTGTGTATGCACACCAACAGG - Intergenic
1085889780 11:80564654-80564676 TTCTATGGAAGTACACAAAAAGG - Intergenic
1086986723 11:93258764-93258786 ATTTCTGTGAGTACACAAAAAGG - Intergenic
1087233050 11:95687490-95687512 TTTTATTTTAGTATAGCAAAGGG - Intergenic
1087472659 11:98596672-98596694 GTTTATGGAAGTGCACTAAAAGG - Intergenic
1091958412 12:4668886-4668908 TTTTATGTAATTACATCAGAAGG + Intronic
1092537258 12:9402316-9402338 GATTATGTAAATACACAAAACGG + Intergenic
1092557420 12:9570981-9571003 GATTATGTAAATACACAAAACGG - Intergenic
1096160308 12:49371011-49371033 TTTTTTTTAAGTAAACAAAAAGG - Intronic
1097444405 12:59650373-59650395 TTTCATGAAAAGACACCAAATGG - Intronic
1097996616 12:65894744-65894766 CTTTATGGAAGTACACCCCAAGG + Intronic
1098573082 12:72011122-72011144 AGTTATGTAAGTTCAGCAAAGGG + Intronic
1100928834 12:99582957-99582979 AATAATATAAGTACACCAAAGGG - Intronic
1101274321 12:103182233-103182255 TTTTATTTAAGAACACAAAATGG - Intergenic
1102544542 12:113645254-113645276 TTTTATGTAGGTCCAGCACATGG - Intergenic
1107574127 13:41698548-41698570 AGTCATGTAAATACACCAAAGGG - Intronic
1108739333 13:53319214-53319236 TTTTCAGAAAGTAAACCAAAAGG - Intergenic
1109297323 13:60551103-60551125 GTTTATATAAGTAGACCAAAAGG - Intronic
1109624650 13:64958859-64958881 TTTTATGTATGTACATGTAATGG + Intergenic
1110034571 13:70665993-70666015 TTTGATGTGAGTATGCCAAAGGG + Intergenic
1110284085 13:73729801-73729823 TTTTCTGTAAGTTCACCATAGGG + Intronic
1111364294 13:87221423-87221445 TTTTGTGTATATACCCCAAATGG - Intergenic
1112537227 13:100271325-100271347 TTTATTGTAACTTCACCAAAAGG + Intronic
1116043840 14:39718618-39718640 TTTTTTGTATGTAAAACAAAGGG + Intergenic
1116582114 14:46654919-46654941 TCTTGTGTATGCACACCAAATGG - Intergenic
1116632192 14:47350223-47350245 TTGTGTGTAAGTTCACCCAAGGG + Intronic
1117215973 14:53552169-53552191 TTTGAGGTAATTACACAAAAGGG - Intergenic
1117638058 14:57768216-57768238 TTTGATGTAGGTAAACCCAATGG - Intronic
1124498427 15:30203257-30203279 TTTTATCTTAGTCCAGCAAAAGG + Intergenic
1124745156 15:32335417-32335439 TTTTATCTTAGTCCAGCAAAAGG - Intergenic
1124812772 15:32958097-32958119 TTCTATGTAACTCCAGCAAAAGG - Intronic
1124907278 15:33882116-33882138 TATTATATAAGTACACAACAAGG - Intronic
1125202110 15:37109262-37109284 ACTTATTTAAGTACATCAAAAGG - Intergenic
1127214010 15:56805035-56805057 TTTAATGTAATTCAACCAAAGGG + Intronic
1128663304 15:69518967-69518989 GTTTGTGTAAGTACACTCAATGG + Intergenic
1129865617 15:78906143-78906165 TTGTATGAAAGTTCACCAAAGGG + Intergenic
1133966856 16:10537911-10537933 TGTCATGTAAGTACATCAACGGG - Exonic
1137310216 16:47248796-47248818 TTTTAAGTAAGTATAATAAATGG + Intronic
1138501640 16:57448712-57448734 TTTTGTATAAATACAACAAAAGG - Intronic
1139024406 16:62796772-62796794 TTTTTGGTAAGTGAACCAAAAGG - Intergenic
1144304857 17:13959910-13959932 TCTTATGTACATACACAAAATGG + Intergenic
1145822218 17:27847625-27847647 ATTTATATAAGTACAGCACATGG - Intronic
1146029984 17:29357781-29357803 ATTTATGTAAGTTCCACAAAAGG - Intergenic
1146087200 17:29840517-29840539 TATTATTTAAGTACATGAAATGG - Intronic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1149709993 17:58732347-58732369 TTTTCTCTAAGAACACAAAAAGG - Intronic
1151906022 17:77050039-77050061 TTTTTTTTAAATACATCAAATGG - Intergenic
1152962435 18:87909-87931 CTTTATGTAAGAACACAAAAGGG - Intergenic
1157405202 18:47417021-47417043 TTTTGTGTAAGTCCATCAAGTGG - Intergenic
1157959525 18:52136963-52136985 TTCTATGTTAGTGCACCCAATGG + Intergenic
1158056193 18:53284185-53284207 TGTTATGTAAGATCACTAAAAGG + Intronic
1159049944 18:63411426-63411448 TTTTATTTAAAAACACGAAAAGG - Intronic
1159087975 18:63816192-63816214 TTACATGTAAGGACACCCAAAGG - Intergenic
1160224676 18:77003145-77003167 TTCTATGTAATTAAAACAAAGGG + Intronic
1160595938 18:79974467-79974489 ATTTATGCCAGTACAACAAAGGG - Intronic
1161832534 19:6617986-6618008 CATTATGTAAGTGCTCCAAAAGG + Intergenic
1164138100 19:22432669-22432691 TTTTATTTAATTACAATAAAAGG - Intronic
1168091371 19:54087304-54087326 TATTAAGTAAGACCACCAAATGG + Intergenic
925545934 2:5016386-5016408 TTTTAGGTAGGTACTCTAAAGGG + Intergenic
925853730 2:8109253-8109275 GTTTATGTAAATGCAACAAAAGG + Intergenic
928298939 2:30108952-30108974 CTTTATGTAAAAACACCTAAAGG + Intergenic
928882368 2:36112307-36112329 TTTTATGTGAGGACTACAAAAGG - Intergenic
929040981 2:37744279-37744301 TTTTATGACAGTAGAGCAAATGG + Intergenic
929188342 2:39118562-39118584 TTTTATGTAAATATGCAAAAAGG + Intronic
929723392 2:44396485-44396507 TGTTCTGTATGTACATCAAATGG + Intronic
933191775 2:79341909-79341931 TTTTATGTATGTCCATGAAAGGG + Intronic
933564816 2:83937400-83937422 TTTCATGTATGTCCCCCAAAAGG + Intergenic
935857581 2:107292039-107292061 TTATCTGTAACTACACAAAATGG + Intergenic
936477754 2:112854818-112854840 TTTTATATGTGTACAACAAAAGG + Intergenic
938713775 2:134000043-134000065 TTTTATGTAAAAATACAAAAAGG + Intergenic
939024619 2:136997467-136997489 TTTTAAAGTAGTACACCAAATGG + Intronic
939304077 2:140387115-140387137 GTTGATCTAAGTACACGAAAGGG - Intronic
939696835 2:145336479-145336501 TTTTAAGTACATACACAAAAAGG - Intergenic
940404619 2:153286720-153286742 TTGTATATCATTACACCAAATGG + Intergenic
940539379 2:154991223-154991245 TTTCACCAAAGTACACCAAAGGG + Intergenic
941402419 2:165046980-165047002 TAATATTTAAGTACAACAAAAGG + Intergenic
942589762 2:177529693-177529715 ATTTATGGAAGAACACTAAATGG - Intronic
945458583 2:210078011-210078033 GTTTGTGTAAGTACACTCAATGG - Intronic
945663258 2:212711910-212711932 TCTTATGAAAGTTCATCAAAAGG + Intergenic
947191298 2:227508076-227508098 TTCTATGTAAATAAACCAAGAGG - Intronic
1169845748 20:9989729-9989751 TTTTTTGTAAATACAGCAACAGG + Intronic
1171022037 20:21593925-21593947 TTTTACGTCTGTACACCTAACGG - Intergenic
1177500737 21:21951112-21951134 TTCTAGGTAAGTACAATAAAAGG + Intergenic
1181647401 22:24240415-24240437 TTTTATGTAAGGATACAGAAAGG + Intronic
949141472 3:638550-638572 TTTTATGAAAGAAAACCACATGG - Intergenic
949690771 3:6635903-6635925 TTTAATTTAATTACACAAAATGG - Intergenic
950271419 3:11618972-11618994 TCTTAAGTAAATATACCAAAGGG - Intronic
951140455 3:19152466-19152488 TTTTGTCTTAGTAAACCAAAAGG - Intronic
951527861 3:23671102-23671124 TTTTATGTAACTACAGGACAGGG + Intergenic
951932679 3:27986282-27986304 CTTAATGTAAGTAGGCCAAAAGG - Intergenic
952014145 3:28937270-28937292 TTTTTTACAAGGACACCAAAAGG + Intergenic
954658236 3:52210887-52210909 GTTTATGTAAGTACACTCTATGG - Intronic
955446284 3:59014554-59014576 TTTTATTTAAGCAAACTAAAAGG + Intronic
956955033 3:74328410-74328432 TATTATGTAAATACAACAGAAGG - Intronic
957160019 3:76599039-76599061 TTTAATGTATATACACCAAATGG - Intronic
959409598 3:106004171-106004193 CTTTAAATATGTACACCAAATGG + Intergenic
959892095 3:111568791-111568813 TTTAATGTTAGTCAACCAAATGG + Intronic
960381978 3:116974047-116974069 TTTTCTGTAACTTCAGCAAAAGG + Intronic
962292991 3:134153041-134153063 TTATATGTAAGTGAACCATATGG - Intronic
963324378 3:143845493-143845515 TTTTCTGAAAGTACTCCATATGG - Intronic
964832895 3:160905656-160905678 GTTTATTTTAGTATACCAAAAGG + Intronic
965563685 3:170087929-170087951 TTTTAAAAAAATACACCAAATGG + Exonic
965673907 3:171174689-171174711 TTTTATGTAAGTTTATCAAAAGG + Intronic
967712164 3:192721815-192721837 TTTTGTTTAAATAAACCAAAGGG + Intronic
972149318 4:36068812-36068834 TTTTATGTATGTTCACCTTATGG + Intronic
973131912 4:46658349-46658371 TTATATGTTGCTACACCAAAAGG - Intergenic
975519267 4:75281066-75281088 TTTTATGTAAGTAGAGCAATGGG - Intergenic
976106915 4:81628941-81628963 ATTTATGTGAGTACCCCAAGTGG - Intronic
977767313 4:100814773-100814795 TTTTAGGTAAGTACACCTATTGG - Intronic
978181336 4:105800038-105800060 TTCTATGTAAGTACAATAAAAGG - Intronic
981058301 4:140390109-140390131 TTTTATATCAGGACACAAAAAGG + Intronic
981419777 4:144535961-144535983 TTATATGTATGAAAACCAAAAGG - Intergenic
981585708 4:146300020-146300042 TTTTGAGCAAGTACATCAAAGGG + Intronic
982126360 4:152187219-152187241 TTTTATGTTATTACAATAAATGG + Intergenic
982740161 4:159049212-159049234 TTTTATTTAAGTAAACAAGAAGG + Intergenic
983176302 4:164592150-164592172 ATTTATTTAAGTATACCTAATGG + Intergenic
983541471 4:168916097-168916119 CTTTATGTAATTTCCCCAAAAGG - Intronic
985393911 4:189521110-189521132 CTTTATGTGAGCACACTAAAAGG + Intergenic
986262077 5:6156289-6156311 TTCTAAGTAAGAATACCAAAAGG + Intergenic
989148286 5:38270457-38270479 GTTTATTTAACTACACCAATTGG - Intronic
989325698 5:40191445-40191467 TTTTACATAAGCACACTAAATGG + Intergenic
989999113 5:50872382-50872404 TTTTCTGTAACTACAGTAAAAGG - Intergenic
990074634 5:51828930-51828952 TTTTAGGTAAGTTCTCAAAATGG + Intergenic
990751197 5:59018646-59018668 TGTTTTCTTAGTACACCAAATGG - Intronic
991763541 5:69948100-69948122 TTTTATGGAAGTTCAGGAAAAGG - Intergenic
992124697 5:73627610-73627632 TTTTCTGCAAATACTCCAAAGGG - Intronic
992266252 5:75021046-75021068 TTTTGTGTAAACACACAAAAAGG + Intergenic
993045830 5:82865510-82865532 TTTTACATAATCACACCAAAAGG - Intergenic
993505362 5:88702265-88702287 TTTTATGTAAAGACACCATTAGG - Intergenic
993660205 5:90623723-90623745 ATTTTTTTCAGTACACCAAATGG + Intronic
994098200 5:95866479-95866501 TTTTATTTAGTTTCACCAAAGGG + Intergenic
994927555 5:106137505-106137527 TCTTATGTTAATAAACCAAATGG + Intergenic
996940099 5:128994362-128994384 TTTTGTGTGAGTTCAACAAAGGG - Intronic
997550720 5:134750043-134750065 TTTTATGTAAATAAAGCACAAGG - Intronic
998722388 5:144968043-144968065 TTTTATGTTAGTCTAGCAAAGGG - Intergenic
1000163316 5:158622425-158622447 TTTGATGAAAGGAAACCAAAAGG - Intergenic
1000315539 5:160086931-160086953 TTTTATGTCAGTACAGTTAATGG + Intronic
1002752802 6:133604-133626 TTTTGTGAAAGTACAACTAAAGG - Intergenic
1002812693 6:648530-648552 TCTTATATAAATACACTAAACGG + Intronic
1003374411 6:5562633-5562655 TTTTATGTAAGTCAGTCAAATGG + Intronic
1004050120 6:12069116-12069138 GTTTGTGTAAGTACACCCCATGG - Intronic
1005342704 6:24858300-24858322 TTTAATGTCACTACCCCAAAAGG + Intronic
1010713190 6:79199007-79199029 TTTTCTATAAATTCACCAAAGGG + Intergenic
1011161458 6:84395247-84395269 TTTTATGTAGCAAAACCAAATGG + Intergenic
1012273151 6:97239995-97240017 TTTTGTTTAAATACAGCAAATGG + Intronic
1012286602 6:97397544-97397566 TTTTATGAAAGAACACCACATGG - Intergenic
1013020773 6:106215135-106215157 TTTTATGTAAGTACACCAAAAGG - Intronic
1013979611 6:116114223-116114245 TTTTCTGTTAGTTCACAAAATGG - Intronic
1015188639 6:130448227-130448249 GTTTATGAAATTCCACCAAAAGG + Intergenic
1015574089 6:134652386-134652408 TTATATGTAAGTACAAAAAGAGG + Intergenic
1016099309 6:140077921-140077943 ATTTCTTTAAGTACACCAGAAGG + Intergenic
1017140760 6:151187934-151187956 GTTTATGTAAGTACACTCTACGG - Intergenic
1018565048 6:165142964-165142986 TTCTATGTAAGTAAACAATATGG - Intergenic
1020492208 7:8801210-8801232 GTTTGTGTAAGTACACCATACGG - Intergenic
1021465598 7:20939563-20939585 TTTTATGTCAGTAACCCAAAGGG + Intergenic
1022815444 7:33909530-33909552 TTTTATGTATGTACATTAAGAGG + Intronic
1023071795 7:36442087-36442109 TTTTATGTAAATTTCCCAAAAGG - Intronic
1023792068 7:43760685-43760707 TTTTTTTTAAATACACAAAAAGG - Intronic
1024386594 7:48759023-48759045 TTTTATGCATGTAAACAAAAAGG - Intergenic
1025970050 7:66314653-66314675 ATTTATGTAAGTACACCCTATGG - Intronic
1026076384 7:67173983-67174005 TTGTATGTAAGCAAACAAAATGG - Intronic
1026670274 7:72384195-72384217 TTTTATGTAAGTCCACATAATGG - Intronic
1026700470 7:72638300-72638322 TTGTATGTAAGCAAACAAAATGG + Intronic
1027634403 7:80652312-80652334 ATTTATGTAAGTACCTAAAATGG - Intronic
1027779673 7:82506528-82506550 TTTTATCTAAATAGACAAAAAGG + Intergenic
1028861334 7:95654459-95654481 TTTTATTTCACTACAACAAATGG + Intergenic
1030179955 7:106696176-106696198 TTTTTGTTAAGCACACCAAAAGG - Intergenic
1031405874 7:121386195-121386217 TATTAAGTAGGTACATCAAAGGG - Intronic
1032315293 7:130832458-130832480 TGTTTTGTAAGTACACTTAAAGG + Intergenic
1033821734 7:145142694-145142716 TTTTATGTCAGTTCACGAAAAGG - Intergenic
1035143745 7:156791486-156791508 TTTTATGTAAGTTTGCCAAAAGG + Intronic
1036103703 8:5816558-5816580 TAGTATGTAAGTACATAAAAGGG + Intergenic
1038900428 8:31836602-31836624 TTTGATGTGAGTACACAAAAAGG + Intronic
1040463072 8:47668720-47668742 TTGCATGAAAGTACACTAAACGG + Intronic
1041843086 8:62294448-62294470 TTTTATTTGACTACACAAAAAGG + Intronic
1043954452 8:86343915-86343937 TTTCAGGTAAAAACACCAAACGG - Intronic
1045262238 8:100586384-100586406 TTTTATTGATGTACACCCAAAGG - Intronic
1046282036 8:112045870-112045892 ATGTATGTAAGTACATGAAATGG - Intergenic
1046480462 8:114810388-114810410 TTTTAGGTACATACACCAAGAGG + Intergenic
1047258935 8:123238842-123238864 TTTTCTGTAACTCCAACAAAAGG - Intronic
1051980973 9:23015888-23015910 TTTTATGTAATTATAGCTAATGG - Intergenic
1052540122 9:29800423-29800445 TTTTTTCTAAGGAAACCAAAAGG - Intergenic
1053084361 9:35205345-35205367 TTTTTTTAAAGTAAACCAAAAGG - Intronic
1056479419 9:86985827-86985849 TTTTGTGTAAGCACACAAAATGG - Intergenic
1058102328 9:100931049-100931071 TTTTCTGTATGTTTACCAAAGGG + Intergenic
1060868262 9:127017199-127017221 GTTTGTGTAAGTACACAATATGG - Intronic
1062735706 9:138136208-138136230 CTTTATGTAAGAACACAAAAGGG + Intergenic
1187498155 X:19814187-19814209 ATTTCTGTAAGTACAGCCAACGG - Intronic
1188012765 X:25075167-25075189 CTTTTTGTGAGAACACCAAAAGG + Intergenic
1192677925 X:73219191-73219213 ACTTATGTAAATACACAAAAAGG + Intergenic
1193843153 X:86434633-86434655 TTCTATGGATGTACACAAAAAGG - Intronic
1196086349 X:111686746-111686768 TTTTGTGTTAGTACATTAAAAGG + Intronic