ID: 1013033492

View in Genome Browser
Species Human (GRCh38)
Location 6:106359095-106359117
Sequence CACAATATGTACTCTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013033492_1013033494 8 Left 1013033492 6:106359095-106359117 CCAGAAACAGAGTACATATTGTG No data
Right 1013033494 6:106359126-106359148 CTAAAATGAAATTCCAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013033492 Original CRISPR CACAATATGTACTCTGTTTC TGG (reversed) Intergenic
No off target data available for this crispr