ID: 1013033630

View in Genome Browser
Species Human (GRCh38)
Location 6:106360384-106360406
Sequence TTGGCCTGTGACAGGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013033630_1013033637 8 Left 1013033630 6:106360384-106360406 CCTGCCAGCCTGTCACAGGCCAA No data
Right 1013033637 6:106360415-106360437 AACAACTCCGCAGGCGACAATGG No data
1013033630_1013033635 -1 Left 1013033630 6:106360384-106360406 CCTGCCAGCCTGTCACAGGCCAA No data
Right 1013033635 6:106360406-106360428 AGAGCGGCCAACAACTCCGCAGG No data
1013033630_1013033639 23 Left 1013033630 6:106360384-106360406 CCTGCCAGCCTGTCACAGGCCAA No data
Right 1013033639 6:106360430-106360452 GACAATGGCCGCTGCACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013033630 Original CRISPR TTGGCCTGTGACAGGCTGGC AGG (reversed) Intergenic
No off target data available for this crispr