ID: 1013036079

View in Genome Browser
Species Human (GRCh38)
Location 6:106384590-106384612
Sequence AAACCCTGCTTCACAAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013036078_1013036079 10 Left 1013036078 6:106384557-106384579 CCGTAATCTCATTTTGCTTGCAG No data
Right 1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG No data
1013036077_1013036079 20 Left 1013036077 6:106384547-106384569 CCAGTCTACTCCGTAATCTCATT No data
Right 1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013036079 Original CRISPR AAACCCTGCTTCACAAAGAT AGG Intergenic