ID: 1013040251

View in Genome Browser
Species Human (GRCh38)
Location 6:106425953-106425975
Sequence TCATGACCACATATGCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013040247_1013040251 4 Left 1013040247 6:106425926-106425948 CCGCTCCCAGCCAGTTTCACTTT No data
Right 1013040251 6:106425953-106425975 TCATGACCACATATGCTGCATGG No data
1013040250_1013040251 -6 Left 1013040250 6:106425936-106425958 CCAGTTTCACTTTAAATTCATGA No data
Right 1013040251 6:106425953-106425975 TCATGACCACATATGCTGCATGG No data
1013040248_1013040251 -1 Left 1013040248 6:106425931-106425953 CCCAGCCAGTTTCACTTTAAATT No data
Right 1013040251 6:106425953-106425975 TCATGACCACATATGCTGCATGG No data
1013040249_1013040251 -2 Left 1013040249 6:106425932-106425954 CCAGCCAGTTTCACTTTAAATTC No data
Right 1013040251 6:106425953-106425975 TCATGACCACATATGCTGCATGG No data
1013040246_1013040251 7 Left 1013040246 6:106425923-106425945 CCACCGCTCCCAGCCAGTTTCAC No data
Right 1013040251 6:106425953-106425975 TCATGACCACATATGCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013040251 Original CRISPR TCATGACCACATATGCTGCA TGG Intergenic
No off target data available for this crispr