ID: 1013040838

View in Genome Browser
Species Human (GRCh38)
Location 6:106431798-106431820
Sequence CCAGCTGGCCCTCTGTAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013040838_1013040848 15 Left 1013040838 6:106431798-106431820 CCACCCTACAGAGGGCCAGCTGG No data
Right 1013040848 6:106431836-106431858 ATCAAGGCTAACATCTCATATGG No data
1013040838_1013040849 16 Left 1013040838 6:106431798-106431820 CCACCCTACAGAGGGCCAGCTGG No data
Right 1013040849 6:106431837-106431859 TCAAGGCTAACATCTCATATGGG No data
1013040838_1013040845 -1 Left 1013040838 6:106431798-106431820 CCACCCTACAGAGGGCCAGCTGG No data
Right 1013040845 6:106431820-106431842 GCTCCCTGGGAATTCTATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013040838 Original CRISPR CCAGCTGGCCCTCTGTAGGG TGG (reversed) Intergenic
No off target data available for this crispr