ID: 1013042685

View in Genome Browser
Species Human (GRCh38)
Location 6:106451574-106451596
Sequence GATTCATTATTTGGGCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013042680_1013042685 14 Left 1013042680 6:106451537-106451559 CCAAATTATCTACAACGCCGTGT No data
Right 1013042685 6:106451574-106451596 GATTCATTATTTGGGCTGACTGG No data
1013042682_1013042685 -3 Left 1013042682 6:106451554-106451576 CCGTGTAGGTTTTGAAGAATGAT No data
Right 1013042685 6:106451574-106451596 GATTCATTATTTGGGCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013042685 Original CRISPR GATTCATTATTTGGGCTGAC TGG Intergenic
No off target data available for this crispr