ID: 1013046305

View in Genome Browser
Species Human (GRCh38)
Location 6:106488927-106488949
Sequence GCTTAGATCCTGGGGATGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013046296_1013046305 19 Left 1013046296 6:106488885-106488907 CCAAATATGGGTCCAGTTTCAAG No data
Right 1013046305 6:106488927-106488949 GCTTAGATCCTGGGGATGGGAGG No data
1013046298_1013046305 7 Left 1013046298 6:106488897-106488919 CCAGTTTCAAGATGGTGTTGTGC No data
Right 1013046305 6:106488927-106488949 GCTTAGATCCTGGGGATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013046305 Original CRISPR GCTTAGATCCTGGGGATGGG AGG Intergenic