ID: 1013049741

View in Genome Browser
Species Human (GRCh38)
Location 6:106520814-106520836
Sequence TCCCATTAGTGTTGGTGTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013049741_1013049743 -8 Left 1013049741 6:106520814-106520836 CCTGCACACCAACACTAATGGGA 0: 1
1: 0
2: 0
3: 15
4: 105
Right 1013049743 6:106520829-106520851 TAATGGGAACAGTGAGCCTCTGG 0: 1
1: 0
2: 0
3: 19
4: 165
1013049741_1013049747 24 Left 1013049741 6:106520814-106520836 CCTGCACACCAACACTAATGGGA 0: 1
1: 0
2: 0
3: 15
4: 105
Right 1013049747 6:106520861-106520883 AAATCAATGACAAAGAGAACAGG 0: 1
1: 0
2: 11
3: 75
4: 711
1013049741_1013049748 25 Left 1013049741 6:106520814-106520836 CCTGCACACCAACACTAATGGGA 0: 1
1: 0
2: 0
3: 15
4: 105
Right 1013049748 6:106520862-106520884 AATCAATGACAAAGAGAACAGGG 0: 1
1: 0
2: 2
3: 52
4: 560
1013049741_1013049744 1 Left 1013049741 6:106520814-106520836 CCTGCACACCAACACTAATGGGA 0: 1
1: 0
2: 0
3: 15
4: 105
Right 1013049744 6:106520838-106520860 CAGTGAGCCTCTGGTGATGCCGG 0: 1
1: 0
2: 1
3: 13
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013049741 Original CRISPR TCCCATTAGTGTTGGTGTGC AGG (reversed) Exonic
900835354 1:4999157-4999179 TCCCAGTAGTGGTGGTGGGGTGG + Intergenic
906743649 1:48206607-48206629 TACCAATAGTGTTTGTGTGTGGG + Intergenic
908740078 1:67318327-67318349 TTCCAATAGTGGTGGTGTGCAGG + Intronic
911294559 1:96099057-96099079 TTGCATTACTGATGGTGTGCAGG + Intergenic
917128785 1:171717752-171717774 TATCATTATTTTTGGTGTGCAGG + Intronic
922547015 1:226465520-226465542 TAAGATTAGGGTTGGTGTGCTGG - Intergenic
1067945640 10:50686574-50686596 TCCCATTGGTGATGGTGTGTTGG - Intergenic
1069567315 10:69472442-69472464 TCCCACATGTGTTGGTGTGCTGG + Intronic
1070867153 10:79713447-79713469 TCCCATTGGTGATGGTGTGTTGG - Intronic
1070880943 10:79851568-79851590 ACCCATTGGTGATGGTGTGTTGG - Intergenic
1071634068 10:87235671-87235693 TCCCATTGGTGATGGTGTGTTGG - Intronic
1071647514 10:87367888-87367910 TCCCATTGGTGATGGTGTGTTGG - Intronic
1071981714 10:91010095-91010117 TCTCAATAGTGCTGGTCTGCAGG + Intergenic
1074999596 10:118785716-118785738 TCCCCTGAGTGTTGATGTGCAGG + Intergenic
1076758700 10:132589321-132589343 TCCCACTAGGCTTGCTGTGCGGG + Intronic
1077546355 11:3171976-3171998 TGCCATTGGTTTTGGTGAGCCGG + Intergenic
1079114801 11:17634341-17634363 ATCCATCAGGGTTGGTGTGCAGG - Intronic
1087069256 11:94060783-94060805 TCCCATCAGTGTTGGGATGAAGG - Intronic
1089382114 11:118041628-118041650 TCCCACAAGTTTTGGTGTACCGG - Intergenic
1093138575 12:15479926-15479948 TTCCCTCAGTCTTGGTGTGCAGG + Intronic
1098045882 12:66400176-66400198 TCCCATTCCTGTTGGTCTGTGGG - Intronic
1100137528 12:91572069-91572091 TCCCATCAGTGGTGGTGTAAGGG - Intergenic
1102512869 12:113427730-113427752 TTCCATAAGTGTGGCTGTGCTGG - Intronic
1105482131 13:20787898-20787920 TCCCATTAGTAATGTTGAGCTGG - Intronic
1108760425 13:53556547-53556569 TCCCAGAAGGTTTGGTGTGCAGG + Intergenic
1111937087 13:94568774-94568796 TGCCATGAGCATTGGTGTGCAGG + Intergenic
1113804982 13:113107284-113107306 TCCCAGGAGTGTGGGTGTCCCGG + Intronic
1113805479 13:113108611-113108633 TCCCAGGAGTGTGGGTGTCCCGG + Intronic
1115210918 14:30966834-30966856 CCCTCTTAGTGTTGGCGTGCTGG - Intronic
1117477966 14:56116914-56116936 TCCCTTTAGTGAAGGAGTGCTGG + Intergenic
1120387412 14:83863684-83863706 TGCTCTTAGTGATGGTGTGCTGG - Intergenic
1123459133 15:20452521-20452543 TCTCATTGGTGATGGTTTGCAGG + Intergenic
1123658927 15:22547897-22547919 TCTCATTGGTGATGGTTTGCAGG - Intergenic
1124265372 15:28228371-28228393 TCTCATTGGTGATGGTTTGCAGG + Exonic
1124312792 15:28642389-28642411 TCTCATTGGTGATGGTTTGCAGG - Intergenic
1125140944 15:36407059-36407081 TCCCTTAAGTGCTGATGTGCAGG - Intergenic
1127133203 15:55889988-55890010 TACAATTAGTCTTGGTGTGGTGG - Intronic
1134443015 16:14310620-14310642 TCCCAGTGGTGTCGGTGAGCAGG - Intergenic
1138074506 16:54027594-54027616 TCCCATGAGTTTAGGTCTGCTGG + Intronic
1138390834 16:56668933-56668955 TCCCTTTAGGGTTGCTGTGAGGG - Intronic
1138392602 16:56681631-56681653 TCCCTTTAGGGTTGCTGTGAGGG + Intronic
1146393887 17:32446360-32446382 TCCCCTAAGTGTAGCTGTGCAGG + Intronic
1152270523 17:79322063-79322085 TTTCATAATTGTTGGTGTGCAGG - Intronic
1153600295 18:6774574-6774596 TCCTATTTCTGTTTGTGTGCTGG + Intronic
1154427248 18:14281399-14281421 TCCCATTTGTGTTGTTTTCCTGG + Intergenic
1154429969 18:14300934-14300956 TCCCATTTGTGTTGTTTTCCTGG + Intergenic
1155746520 18:29361666-29361688 CCCTCTTAGTGTTGGCGTGCTGG + Intergenic
1157255190 18:46132454-46132476 TTCCATTAATGTAGGTCTGCTGG - Intergenic
1159788803 18:72750573-72750595 TCCCACTGGTGTTGGTCAGCTGG + Exonic
1160400121 18:78604072-78604094 TCTCATTAGTGAGGGTTTGCCGG - Intergenic
1161964334 19:7540055-7540077 TCCGGTCAGTGTTGGGGTGCAGG + Exonic
1165698300 19:37918048-37918070 TTACATTGGTGTCGGTGTGCTGG + Intronic
1167813354 19:51854762-51854784 TTACATATGTGTTGGTGTGCTGG + Intergenic
926319743 2:11741102-11741124 TCCCATTTGTGCTGCTGTGAAGG - Intronic
926647612 2:15306413-15306435 ACCCAATAGTGATGGTGTCCTGG + Intronic
929237689 2:39624090-39624112 TCCCAATAGTGCTGCAGTGCTGG + Intergenic
933099553 2:78235955-78235977 TTCCTTTAGTGTGGGTCTGCTGG + Intergenic
937057572 2:118952372-118952394 CCCTTTTAGTGTTGGCGTGCAGG + Intronic
947861706 2:233364284-233364306 TTCCTTTAGTGTGGGTCTGCTGG - Intronic
1173742707 20:45412694-45412716 TCCCAATAGCTTTGCTGTGCAGG + Intergenic
1174005907 20:47410526-47410548 TTCCATTGGTGTTGCTGTGCTGG + Intergenic
1174019805 20:47520831-47520853 CCCTCTTAGCGTTGGTGTGCTGG + Intronic
1174955323 20:55091353-55091375 TCCCATTAGGGTTGCTGAGCTGG + Intergenic
1175838543 20:62012021-62012043 TCCCAGAAGGGTTTGTGTGCAGG - Intronic
1177016624 21:15797569-15797591 TTCCTTTGGTGTGGGTGTGCTGG - Intronic
1177104833 21:16942969-16942991 TCCCAATAGTGTGGGAATGCTGG + Intergenic
1178441606 21:32602992-32603014 TCCAGTTTTTGTTGGTGTGCAGG + Intronic
950531397 3:13554117-13554139 CCCCAGTAGGGTTGGTGTGAAGG + Intronic
952670040 3:35955337-35955359 TGCCATTGGTGGTGGTGTTCAGG - Intergenic
953422164 3:42762539-42762561 TCCCCTGAGTCTTGGTGTCCAGG - Intronic
954604440 3:51897881-51897903 TTGCCTTAGTGTTGGCGTGCTGG - Intronic
955728138 3:61954306-61954328 TGGTATTAGTGGTGGTGTGCTGG + Intronic
957271113 3:78031209-78031231 TCATATTAGTGATGGTGTTCAGG + Intergenic
959137666 3:102444839-102444861 TCACATTAGTATTGATGTACTGG - Intronic
961626255 3:128265878-128265900 TCCTATTAGTTTTGTTTTGCTGG + Intronic
962376259 3:134861189-134861211 TGACATTAGTGTTGGGGGGCAGG + Intronic
965626883 3:170690563-170690585 TCCCCCTAGTGGCGGTGTGCCGG + Intronic
968253062 3:197240264-197240286 TCCCAGTAGTGTGGGAATGCTGG - Intronic
971007185 4:22388427-22388449 TCCCATTAGAGTTGGGGGGCTGG + Exonic
973911182 4:55582393-55582415 TCCCATTAGTGCTGGGAAGCAGG - Intronic
978583683 4:110256477-110256499 TCCCTTTAGTGTTGCTGTAAAGG + Intergenic
981958290 4:150505110-150505132 TCCCATTATTATTGTTGTGTGGG - Intronic
985581847 5:701816-701838 TCCCATTAGTGTAGGATTGTTGG + Intergenic
985596463 5:793129-793151 TCCCATTAGTGTAGGATTGTTGG + Intergenic
985784948 5:1888421-1888443 CCCCATTAGTGGCGATGTGCGGG + Intergenic
991215478 5:64154232-64154254 CCCTCTTAGTATTGGTGTGCTGG - Intergenic
999691824 5:154153235-154153257 TTCCTTTAGTGTAGGTCTGCTGG - Intronic
1001558766 5:172655429-172655451 CCCTCTTAGTGTTGGTGTGCTGG + Intronic
1003071445 6:2948330-2948352 TCCCGTTGGTCTTGCTGTGCTGG + Exonic
1007582993 6:42970251-42970273 TCCCATTGGTGTGGGTGGGTAGG - Intronic
1008806394 6:55434176-55434198 TCCCATTACTGCCAGTGTGCAGG + Intergenic
1012133762 6:95529284-95529306 TCACATTAGTTGTGGTGTGAAGG - Intergenic
1012331944 6:98002346-98002368 TTCCATAAGTGTTGATGTGCAGG - Intergenic
1013049741 6:106520814-106520836 TCCCATTAGTGTTGGTGTGCAGG - Exonic
1014259936 6:119204712-119204734 TCTCATAAGTGTTGCTTTGCAGG + Intronic
1015715558 6:136188822-136188844 TCTCTTTATTATTGGTGTGCTGG - Intronic
1016203542 6:141443511-141443533 TCCCATAAGTTTTGTTGTGAAGG + Intergenic
1016247302 6:141998014-141998036 TCCCATTGGGCTTGGTATGCTGG - Intergenic
1024566727 7:50687436-50687458 TCCCAATAGTGTTTCTGTCCAGG + Intronic
1028793448 7:94878658-94878680 TCGTCTTAGTGTTGGTGTGCCGG - Intergenic
1036103104 8:5809214-5809236 CCTCATTAGCATTGGTGTGCTGG - Intergenic
1037077315 8:14736490-14736512 TCCCATAAGTTTTGAGGTGCAGG + Intronic
1039624151 8:39030547-39030569 TGCCATAAGTGTCCGTGTGCAGG + Intronic
1041468604 8:58183495-58183517 TCCCATTTATGTTGTTGTCCTGG - Intronic
1042774265 8:72412391-72412413 TCCCATTATAGGTGGTCTGCAGG - Intergenic
1049751738 8:144287911-144287933 TCCCAGTAGTTTCGGTGTTCTGG - Intronic
1052031716 9:23636635-23636657 TCCCATTAGGCCAGGTGTGCTGG + Intergenic
1054879482 9:70129930-70129952 TCCCATTTCTGGTGGTGTGCTGG + Intronic
1057270554 9:93648242-93648264 TCCCAGTGGTGTTGCTGAGCAGG + Intronic
1057353291 9:94317490-94317512 TCCCGTTGGTGATGGTGTGTTGG + Intergenic
1057654460 9:96940102-96940124 TCCCGTTGGTGATGGTGTGTTGG - Intronic
1057776214 9:98012615-98012637 TCCCATCAGTGTGTCTGTGCTGG + Intronic
1060165098 9:121406246-121406268 TGCCATGAGCATTGGTGTGCAGG + Intergenic
1060572599 9:124656335-124656357 TCCCTTTAGTGTTGCTGTAAAGG - Intronic
1061918697 9:133770338-133770360 TCCGAGGAGTGCTGGTGTGCCGG + Intronic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1190652415 X:52580064-52580086 TCACATTTGAGTTGGTGCGCTGG + Intergenic
1192815627 X:74587984-74588006 TCACATTAGTGTTGGAATGTAGG - Exonic
1195244973 X:102987348-102987370 GCCCATTTGAGTTGGTGTGTTGG + Intergenic
1197836407 X:130698739-130698761 TCCCATCAGAGTTGGTCTGTTGG + Intronic
1198742127 X:139852761-139852783 CCCTGTTAGTGTTGGTGTGCTGG - Intronic