ID: 1013052162

View in Genome Browser
Species Human (GRCh38)
Location 6:106546903-106546925
Sequence CAGAGGAAGCAAAAGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 429}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013052156_1013052162 -5 Left 1013052156 6:106546885-106546907 CCTAGTCATCCACCCTGGCAGAG 0: 1
1: 0
2: 0
3: 17
4: 192
Right 1013052162 6:106546903-106546925 CAGAGGAAGCAAAAGGATGCTGG 0: 1
1: 0
2: 1
3: 28
4: 429
1013052154_1013052162 23 Left 1013052154 6:106546857-106546879 CCAGTTGTGTTGGTTCTATTAGT 0: 1
1: 0
2: 2
3: 11
4: 130
Right 1013052162 6:106546903-106546925 CAGAGGAAGCAAAAGGATGCTGG 0: 1
1: 0
2: 1
3: 28
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013052162 Original CRISPR CAGAGGAAGCAAAAGGATGC TGG Intronic
900236939 1:1597486-1597508 CTGAGGAAGCAAAAACAGGCGGG - Intergenic
900614107 1:3556751-3556773 CAGTGAAAACACAAGGATGCAGG + Intronic
900861040 1:5231581-5231603 CATAGGAAGCAGAAGGAAGAGGG + Intergenic
901016070 1:6231578-6231600 CAGAGGCAGAAACAGGATGAAGG + Intronic
901507605 1:9695314-9695336 CGGAGGAAGGAAAAGTATGTAGG + Intronic
901880216 1:12189342-12189364 CAGTGGAGGCAACAGGAAGCAGG - Intronic
902626620 1:17680243-17680265 CTGAGGAAACAGCAGGATGCTGG - Intronic
903195322 1:21682478-21682500 CATAGGAAGCATAAGAAAGCTGG - Intronic
905118970 1:35667100-35667122 CAGAGGAGGCAAGAGGAAGAAGG - Intergenic
905248574 1:36631428-36631450 CAGAGAAAGCAAAGGGATGTAGG - Intergenic
905585994 1:39118863-39118885 AGGAGGAGACAAAAGGATGCTGG - Intronic
905781035 1:40709506-40709528 CGGAGGAAACAAAAGGCAGCAGG - Intronic
906299539 1:44672087-44672109 GATAGGAAGCAAATGGATTCAGG + Intronic
907398973 1:54212727-54212749 CAGAGGAAGAAAAGGGATATAGG + Intronic
907418899 1:54333267-54333289 CAGAGGAGGCGGGAGGATGCAGG - Intronic
908747964 1:67394095-67394117 CAGTGGAAGCAAAAGTGTGTGGG + Intronic
909155711 1:72073059-72073081 GTGAGGGAGGAAAAGGATGCAGG + Intronic
909601507 1:77466180-77466202 CAGCGGATGCAAAGGGCTGCAGG - Intronic
911094656 1:94045585-94045607 GAGAGAAAGCAGATGGATGCAGG + Intronic
912313259 1:108644236-108644258 CAGTGGAGGCAAAAGTGTGCAGG + Intronic
912968443 1:114257892-114257914 CAGAGAAAGGAACTGGATGCTGG + Intergenic
912972671 1:114298730-114298752 CAGAGAAACCAAAAGGAGGCTGG - Intergenic
913061137 1:115209249-115209271 AAGAGGAAGACAAAGGATCCAGG + Intergenic
914229333 1:145750761-145750783 CAGAGGCAGCAAAAGGGTTGTGG + Intronic
916354692 1:163891686-163891708 CAGAGCAAGCTAATGGAAGCTGG + Intergenic
916474235 1:165153345-165153367 CAGGTGAAGAAAAAGGATGGTGG + Intergenic
916889890 1:169105249-169105271 CAGTGGAAGCAGAAGCATCCCGG + Intergenic
918177819 1:182060780-182060802 CAGGGACAGCAAAGGGATGCTGG + Intronic
918309472 1:183275490-183275512 CAGAGGCAGCAGAAGGATTTGGG - Intronic
919570169 1:199238643-199238665 CAGATGCAGCAAATGTATGCAGG - Intergenic
920074109 1:203324633-203324655 CTGAAGAGGCAAAACGATGCGGG + Intergenic
921171084 1:212550310-212550332 AAGAGGAAGGCAAGGGATGCTGG - Intergenic
923925750 1:238625459-238625481 CAGAGGAAGTAATAGGATGATGG + Intergenic
924657644 1:245988048-245988070 CAGAGGAATCACTAGGAGGCAGG + Intronic
1064113109 10:12555335-12555357 CAGAAGAAGCTACAGCATGCGGG + Intronic
1065967178 10:30779802-30779824 GAGAGGAAGCACAAGGAGGCAGG - Intergenic
1067545235 10:47188119-47188141 CAAAGGAGGCAAAAGCCTGCAGG + Intergenic
1068797421 10:61099000-61099022 CAGAGGATGCTAAAGGAATCTGG + Intergenic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070384236 10:75909876-75909898 TGGAGTAAGCAAAAGAATGCTGG + Intronic
1071490597 10:86133996-86134018 CAGAGGAAACAAAAGGAAAGAGG + Intronic
1073068143 10:100776237-100776259 CATAGGGAGTAAAAGGAGGCAGG - Intronic
1073318415 10:102599150-102599172 CACAGGAAAGAAAAGGATGGTGG + Intronic
1075222974 10:120600648-120600670 CAGAGGAAGCAGAAGCAAGCCGG - Intergenic
1076026437 10:127118620-127118642 CAGAGCAAGTAAAAGGGTGTTGG - Intronic
1076535024 10:131171472-131171494 CAAAGGCAGCACCAGGATGCGGG + Intronic
1076942685 10:133620321-133620343 CAGTGGAAGCTGGAGGATGCCGG - Intergenic
1077727765 11:4692713-4692735 CAGAGGAAAAGAAAGGGTGCTGG + Intronic
1078353794 11:10618176-10618198 CAGCAGAAGCAAAAGCATGTAGG - Intronic
1078926541 11:15880448-15880470 GAAAGGAAGTAAAAGGAAGCTGG + Intergenic
1079738620 11:24029648-24029670 CAGAGGAAGCAGGAGTATGTGGG - Intergenic
1080273291 11:30473717-30473739 CAGAAGGAGCAGAAAGATGCAGG - Intronic
1080577036 11:33609412-33609434 CAGAGGAACCAAAAGGGTATAGG + Intronic
1080849876 11:36058992-36059014 CAGAGGGAGGTAAAGGAAGCAGG - Intronic
1081197472 11:40178850-40178872 CAGAGGAAGGGAAAGGCTACTGG - Intronic
1081792871 11:45801379-45801401 AAGAGGAAGAAAAAGCATGGAGG + Intergenic
1081794616 11:45810953-45810975 CAGGGGCAGGAAGAGGATGCAGG - Exonic
1081815073 11:45934450-45934472 CAGAGGGAGAAAGAGCATGCGGG + Intronic
1082161310 11:48891963-48891985 CAGAGTAAGCAAATGAATTCAGG + Intergenic
1082199150 11:49342081-49342103 CAAAGGAAGCAAAAGGACAAGGG + Intergenic
1082872903 11:57960184-57960206 CTGAGGAAGCAAAGGGAGGTGGG - Intergenic
1083230148 11:61312154-61312176 CAGAGGAAGAAAAACAAGGCAGG + Intronic
1083460485 11:62807648-62807670 AAGAGGAAACAAAAGGACACTGG + Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1085104395 11:73829696-73829718 CAGAGGAAGCACAAGAACTCTGG - Intronic
1085127485 11:74011488-74011510 CAGAGGGTGCAAAATGATGCGGG - Intergenic
1085484379 11:76849464-76849486 CAGAGCAAGAAGAAGGATTCTGG + Intergenic
1085676096 11:78520214-78520236 CAGAGGAAGCACAACCTTGCTGG - Intronic
1085973135 11:81618261-81618283 CTGAGAAAGGTAAAGGATGCAGG + Intergenic
1086656667 11:89366044-89366066 CAAAGGAAGCAAAAGGACAAGGG - Intronic
1087699608 11:101420856-101420878 TGGTGGAAGCAAAAGGAAGCAGG + Intergenic
1088072932 11:105812184-105812206 CAGAGAAAACAAAGGAATGCTGG - Intronic
1089629284 11:119774089-119774111 CAGAGGAAGCCAACAGAGGCAGG - Intergenic
1089742105 11:120591566-120591588 CAGAGGAGGCAGAAGGCAGCTGG - Intronic
1090131717 11:124149422-124149444 CGGAAGAAGAAAAAGGATACAGG - Intergenic
1090234067 11:125133495-125133517 AGGAGGAAGCAAAAGGGTGTGGG - Intergenic
1090562775 11:127950617-127950639 CATCGGAAGCAAAAAGATGGAGG - Intergenic
1091297702 11:134485534-134485556 CAGGGGCAGCAGAAGGATGTGGG + Intergenic
1092001945 12:5039953-5039975 CAGAGGAATAAAAAAGAAGCTGG + Intergenic
1095307927 12:40660141-40660163 CAGAGGAGGGAATAGGATCCAGG - Intergenic
1095392590 12:41726768-41726790 CAGAGGATGGAAATGGAAGCTGG + Intergenic
1095801162 12:46270481-46270503 CAGAGGAAGAAATTGAATGCAGG - Intergenic
1095995587 12:48081005-48081027 CAGAGGAGGCAAAAGAAGGAAGG + Intronic
1096122433 12:49097034-49097056 AAGGGGAAGGAAAAGGATGGTGG + Exonic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096655333 12:53087196-53087218 GAGAGGAAGCAAAAGGTTAGAGG + Intergenic
1096818167 12:54214879-54214901 CAGAGGGCGCAATAGGAGGCGGG + Intergenic
1097005390 12:55913036-55913058 CAGAGGAAGCAAAAGCAAAAAGG - Intronic
1097162717 12:57060179-57060201 CAGAGTAAGGACAAGGATGTTGG - Intronic
1097326496 12:58283222-58283244 CAGAGAAGGCAACAGGATTCTGG - Intergenic
1097801106 12:63915418-63915440 CAGAGGAACCAAAAGAATGGGGG + Intronic
1098256459 12:68621098-68621120 CAGAGGAAGAAAAAGGTTTAGGG + Intronic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1099133643 12:78865338-78865360 AAGAGGAAGCAAGAAGATGGGGG - Intronic
1100887483 12:99087398-99087420 CGGAGGAAGCAGAATGATCCAGG + Intronic
1101645855 12:106630372-106630394 CAGAGGAGGCGAGAGGAAGCAGG + Intronic
1101683662 12:106995033-106995055 CAGAGGAGGCCCAATGATGCAGG + Intronic
1102300148 12:111765895-111765917 CAGAGGAAGAAAAGGCATGGGGG - Intronic
1103463911 12:121126826-121126848 CAGAGGAAGGTAAAGCCTGCTGG + Intergenic
1104373607 12:128245256-128245278 CAGAGGAGACAAGAGGATGTGGG - Intergenic
1104877911 12:132049321-132049343 AAGAGTAAGCAAAGGGAAGCAGG - Intronic
1104914843 12:132259327-132259349 CAGAGGGACTAAAAGGCTGCCGG + Intronic
1105640535 13:22259503-22259525 CAGAGGAAGCCAACTGATACAGG - Intergenic
1106469099 13:30038934-30038956 CACAGAATGCAAAAGGATGCTGG + Intergenic
1106514053 13:30437844-30437866 CACAGGAATCAAGAGGATGATGG - Intergenic
1107758485 13:43651240-43651262 AAGAGGAAGAAAAAGGAAGAGGG + Intronic
1107842596 13:44474662-44474684 AAGAGGAAGAGAAAGGATGAAGG + Intronic
1107859838 13:44650292-44650314 GAGAGGGAGCAAAAGAAGGCAGG - Intergenic
1107965947 13:45598440-45598462 CAAAGCAAGCAGAAGGATTCTGG - Intronic
1109131714 13:58595066-58595088 CAGATAAAGCCAAAAGATGCTGG + Intergenic
1109178303 13:59182448-59182470 CAGAGGAAAAAAAAGCATGAAGG - Intergenic
1109918825 13:69028228-69028250 CAGAAGAGGCAAAAGGAAGGGGG + Intergenic
1110338136 13:74356544-74356566 CACAGGATACAAAAGAATGCAGG - Intergenic
1111691953 13:91575636-91575658 CAGAGGAACAAAAAAGCTGCAGG - Intronic
1111725815 13:92007533-92007555 CAAACGAATCATAAGGATGCTGG - Intronic
1111896676 13:94150578-94150600 CAGAGAAAGAAAAATGTTGCAGG - Intronic
1112371971 13:98802160-98802182 CAGACAAAGCAAAAGGAGACTGG - Intronic
1113705778 13:112432186-112432208 CAGAGAAAGCACAAAGATGTAGG + Intronic
1114048989 14:18903952-18903974 CAGAGATAGCTAAAGGATACAGG + Intergenic
1114113574 14:19497981-19498003 CAGAGATAGCTAAAGGATACAGG - Intergenic
1114115274 14:19615731-19615753 CAGAGATAGCTAAAGGATACCGG - Intergenic
1116696094 14:48180542-48180564 GAGAGGAAGGAAAAGGAAGAAGG - Intergenic
1117244432 14:53870166-53870188 CAGAGGAAGCAGGAGGAAGTGGG + Intergenic
1117627139 14:57651564-57651586 CACAGGAAGCAAGAGGAACCAGG + Intronic
1118458274 14:65964564-65964586 CAGGGGAAGCCAAGGAATGCTGG + Intronic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1120844710 14:89115674-89115696 CACAGAGAGCAAACGGATGCTGG + Intergenic
1121660723 14:95633066-95633088 CAGAGGAAGCCATGGGAGGCAGG + Intergenic
1124344273 15:28911343-28911365 CAGGGGAAGCAAAATGGTCCAGG - Intronic
1124962217 15:34407475-34407497 CAGGGGAAGCAAAATGGTCCAGG - Intronic
1124978840 15:34553696-34553718 CAGGGGAAGCAAAATGGTCCAGG - Intronic
1125209458 15:37196498-37196520 CAGAGGATACCAAAGGCTGCAGG - Intergenic
1125487938 15:40125253-40125275 CTGAGGAAGGAAATGGATACAGG + Intergenic
1126744511 15:51812536-51812558 CAGAGGAAGCATAAAAATTCTGG + Exonic
1128284508 15:66425152-66425174 CACAGGAAGGGAAAGAATGCTGG - Intronic
1129541777 15:76355923-76355945 CAGAAGATGCAAATGGATGTAGG + Intronic
1130314399 15:82782639-82782661 CAGTGGAATCAAATGGATGCTGG + Intronic
1130330154 15:82916134-82916156 CAGAGGAAACAAAATAATGGGGG + Intronic
1131254454 15:90852830-90852852 CAGGGCAGGCAAAAGGATGTGGG + Intergenic
1133846711 16:9461049-9461071 AAGAAGGAGGAAAAGGATGCAGG + Intergenic
1135472569 16:22744490-22744512 CAGAGAAAGGAAGAGGATGGAGG + Intergenic
1135916100 16:26606848-26606870 CAGAGATTGCAAAAGGTTGCAGG - Intergenic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1137706592 16:50539794-50539816 CAGAAGAAACAAAATGATGTGGG + Intergenic
1138229127 16:55324825-55324847 CAGGGGAAGGAAGAAGATGCGGG - Exonic
1138809154 16:60128538-60128560 GAGAGGGTGAAAAAGGATGCTGG + Intergenic
1138875480 16:60943409-60943431 CAGAGGAAAAAAATGGAGGCGGG + Intergenic
1138970573 16:62138156-62138178 CAGAGGAGGCTAAGGGAAGCTGG - Intergenic
1139381855 16:66537444-66537466 CAGAGGCAGGAAACGGAGGCAGG - Intronic
1140296208 16:73711979-73712001 AAGGGGAAGCAAAAGAAAGCAGG + Intergenic
1140708778 16:77657016-77657038 CATCTGAAACAAAAGGATGCGGG - Intergenic
1141091062 16:81130626-81130648 CACAGGAAGCCCAAGTATGCTGG + Intergenic
1141417337 16:83886148-83886170 AGGAGGAAGCAGAAGGAGGCTGG + Intergenic
1142053051 16:87972961-87972983 TGGAGGAAGCAAAGGGAAGCAGG - Intronic
1142181404 16:88672638-88672660 CAGGGGAAGCAAAAAGGAGCTGG + Intergenic
1143090534 17:4446969-4446991 CAGAGGGAAGAAAAGGAAGCTGG - Intronic
1143115765 17:4581169-4581191 CAGTGGAACCGATAGGATGCTGG - Intergenic
1143320866 17:6068191-6068213 AAGAAAAAGCAAAAGGCTGCTGG - Intronic
1145034611 17:19532523-19532545 CACAGGAAGAGAAAGGCTGCCGG + Intronic
1146150834 17:30469513-30469535 CACATGAAGGAAAATGATGCTGG - Exonic
1147547331 17:41412161-41412183 CAGAGGTAGGAAAAGAATGTGGG - Intergenic
1147557120 17:41486572-41486594 CTGAGGAAACAAAATCATGCAGG + Intronic
1148290050 17:46438021-46438043 CAGAGGAAGCCAAAGTAATCAGG - Intergenic
1148312218 17:46655593-46655615 CAGAGGAAGCCAAAGTAATCAGG - Intronic
1148714178 17:49704027-49704049 TAGAGGGATCAAAAGGATGAGGG + Intronic
1148758077 17:49985059-49985081 CAGGAGAAGCAATTGGATGCTGG + Intergenic
1150435010 17:65146983-65147005 CTGAGGAGGCAACAGGCTGCAGG - Intronic
1150649638 17:67001404-67001426 CTGAGGCGGCAAAAGGAGGCTGG - Intronic
1150864502 17:68835333-68835355 CAGAGGAAGCAAAATGATACAGG - Intergenic
1151331341 17:73411046-73411068 CAGAGGAAGGAAGGGGAGGCCGG - Intronic
1151576851 17:74956810-74956832 GAGAGGAAGCAGAAGGAGCCAGG - Intronic
1152366095 17:79857328-79857350 CACAAGAAAGAAAAGGATGCGGG - Intergenic
1153250720 18:3118960-3118982 CAGAGGAAGCAAGAGGCACCAGG + Intronic
1153324553 18:3804631-3804653 CAGACGCAGTGAAAGGATGCTGG + Intronic
1154319553 18:13336081-13336103 GAGAGGAAGCAAGAGAGTGCAGG + Intronic
1157161083 18:45315143-45315165 CAGAGGAAGCTTCAGGAGGCAGG + Intronic
1157779813 18:50428237-50428259 CAGAGCAAGCAAAGGGAGGGAGG + Intergenic
1157963715 18:52184525-52184547 AAGTGGAAGAAAAATGATGCAGG - Intergenic
1157995910 18:52555636-52555658 CACAGGAAGCAGAAGGACTCAGG + Intronic
1158696203 18:59706450-59706472 CAGAGGAAGAAATAGGATTGGGG - Intergenic
1158866035 18:61638581-61638603 AAGAGGAAGCCAAGGGTTGCAGG - Intergenic
1159385430 18:67718825-67718847 CACAGGAAGCAAAGAGATTCAGG - Intergenic
1159507599 18:69357033-69357055 CAAGAGAAGCATAAGGATGCTGG - Intergenic
1161553707 19:4928625-4928647 CATAGGAAGCTCATGGATGCTGG + Intronic
1162178481 19:8849115-8849137 CAGAGGAAGCATAAGGCCTCTGG - Intronic
1164258935 19:23552536-23552558 AAGAGAAAGCAAAAAGAGGCTGG - Intronic
1165490905 19:36122074-36122096 CAGAGGAAGCACCTGGAGGCTGG + Intronic
1166224864 19:41388598-41388620 TAGAGGAGGAAAAAGGAAGCAGG - Intronic
1166302753 19:41921689-41921711 CAGAGGCAGGAGAGGGATGCAGG + Intronic
925652814 2:6109882-6109904 CAAATGCAGCAAAAGGAGGCAGG - Intergenic
925990481 2:9250534-9250556 CAGAGGGTACAAAAGGATACAGG + Intronic
926104531 2:10142041-10142063 CAGAGGGAGCCAGAGGATGTGGG + Intronic
926592108 2:14750968-14750990 GAGAGGAAAGAAAAGGATGAGGG + Intergenic
928838191 2:35573331-35573353 AAAAGAAAGCAAAAGCATGCAGG - Intergenic
930262450 2:49163576-49163598 CAAAGGAAGGAACAGTATGCTGG + Intergenic
930730271 2:54722737-54722759 AAGAGGCTGCAAAAGGATGATGG - Intergenic
931067836 2:58606828-58606850 CAGAGAGAACAAAAGGATGTGGG + Intergenic
931135153 2:59390929-59390951 TAGAGGAAGCAATGGGATGTGGG - Intergenic
932649158 2:73536977-73536999 CAGAGGATGCAAAATGGAGCTGG + Intronic
932783319 2:74577753-74577775 CAGAGGAAATAAGAGGAAGCTGG - Intronic
932910875 2:75805037-75805059 AAGAGGAAGCAGAAGGTTGGTGG + Intergenic
933030846 2:77326818-77326840 CAGAGGAAGGGAAAGTAGGCTGG - Intronic
933935308 2:87199097-87199119 CAGAGGAAGCAATAAGGTGGGGG + Intergenic
935129028 2:100247595-100247617 CAGAGGCAGGACGAGGATGCAGG + Intergenic
935144620 2:100387060-100387082 CAGAGGAAAGAAAGGGATGATGG - Intergenic
936058861 2:109281524-109281546 CAGAGCATGCAAAGGGATGAGGG + Intronic
936357839 2:111766802-111766824 CAGAGGAAGCAATAAGGTGGGGG - Intronic
936378788 2:111965841-111965863 CAGAGGAAACAAGAGGAAGAGGG - Intronic
936876316 2:117193960-117193982 CAGAGGAAGCTAGAGTTTGCTGG + Intergenic
936950011 2:117968229-117968251 CAGAAGAAAGAAAAGGAAGCTGG - Intronic
937183540 2:120017145-120017167 GAGAGGGAGCAAAAGAATTCAGG - Intronic
937208641 2:120253050-120253072 CGGAGGGAGCAAGAGGCTGCGGG - Intronic
938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG + Intergenic
938699889 2:133866777-133866799 AAGAGGGAGAAAAAGGATGTGGG - Intergenic
938881893 2:135598827-135598849 CAAAGGAAAGAAAAGGATGGGGG - Intronic
939373847 2:141338305-141338327 AAGAGGAAGCAGAAGAAAGCAGG + Intronic
941276672 2:163498469-163498491 CAGAGGAAGGAACAGGCAGCAGG + Intergenic
941751461 2:169139265-169139287 CAGAGCAGGCAAAAGGGAGCCGG + Exonic
942239158 2:173943105-173943127 CAGAGTAAGCATAAGGCTGATGG - Intronic
942364101 2:175204592-175204614 CAGAGGGAGCCAAAGTATGATGG + Intergenic
942495320 2:176534044-176534066 CAGAGGAAGCAGAAGGGATCAGG + Intergenic
942903961 2:181158543-181158565 TAGAGGAAGCAAATGGATTCAGG + Intergenic
943308127 2:186292529-186292551 CAAAAAAAGAAAAAGGATGCAGG + Intergenic
943690193 2:190861713-190861735 AAGAAGTAGGAAAAGGATGCTGG + Intergenic
944044668 2:195395627-195395649 CATATGAACCAAAAGGATGATGG + Intergenic
947387400 2:229605271-229605293 GACAGGAAGCAAAGGGATGAGGG + Intronic
948169157 2:235887386-235887408 CAGAGGAGAGAAAAGGAGGCAGG - Intronic
1168863580 20:1064278-1064300 AAGAGGAAGAAAAAGGAGGGAGG + Intergenic
1168873190 20:1148364-1148386 CAGATGAAGCAAAAGGAAATAGG - Intronic
1169000333 20:2163631-2163653 CAGAGGAAGCAAGGGGAAGAAGG + Intronic
1169035894 20:2451840-2451862 AAGAGAATGCCAAAGGATGCTGG + Intergenic
1169276216 20:4235339-4235361 TAGAGGATGCAAGAGGATGCGGG - Intronic
1169676033 20:8156119-8156141 CAGACAAAGCAAAAGAATGCAGG - Intronic
1170046195 20:12087973-12087995 CTAAGGAAGCAGAAGAATGCTGG - Intergenic
1170164143 20:13344704-13344726 ATGAGGAAGGCAAAGGATGCCGG - Intergenic
1170238679 20:14137420-14137442 AAGCTGAAACAAAAGGATGCTGG - Intronic
1170897162 20:20425845-20425867 CAGAAGTAGCAAAAGTATGTTGG + Intronic
1175094447 20:56530252-56530274 CATAGGCAGGAAAAGGATTCTGG + Intergenic
1175572749 20:60036621-60036643 CAGAGTAAGCAAAAGCCTGGAGG - Intergenic
1176281938 20:64318252-64318274 CAGAGAAAGGAAAAGGAACCGGG + Intergenic
1177488789 21:21794193-21794215 CTGAGGAACCAAGAGAATGCCGG - Intergenic
1178358518 21:31928968-31928990 TGGATGATGCAAAAGGATGCAGG + Intronic
1178943309 21:36925566-36925588 CAGAGGAAGCAGAAGAAGGTGGG - Intronic
1179290603 21:40014714-40014736 AGAAGGAAGCAAAAGGAAGCAGG - Intronic
1179461911 21:41541646-41541668 CAGAGGGAGCAGATGGATTCAGG + Intergenic
1180467471 22:15626336-15626358 CAGAGATAGCTAAAGGATACCGG + Intergenic
1182325497 22:29509555-29509577 CAGATGAGGTGAAAGGATGCTGG + Intronic
1183079650 22:35448327-35448349 CAGAGGGAGACAAAGGAGGCTGG - Intergenic
1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG + Intronic
1184348589 22:43928187-43928209 CAGAGGATGCAACTGGCTGCAGG - Intronic
1184635146 22:45822087-45822109 GACAGGAAACAAAAGAATGCAGG - Intronic
1184672953 22:46025177-46025199 CAGAGGGAGCAAGAGGGTACAGG - Intergenic
1184673000 22:46025421-46025443 GAGAGGGAGCAAGAGGGTGCAGG - Intergenic
1185304942 22:50109852-50109874 AAGAGAAAGGAAAAGGAGGCTGG + Intronic
949189637 3:1236200-1236222 CGGAGGATGCAAAAGTATTCAGG - Intronic
950047139 3:9955467-9955489 CAGAGTCTGCAGAAGGATGCTGG - Intergenic
950099232 3:10346949-10346971 GAGAGGAAACAAAGTGATGCTGG - Intronic
950229021 3:11259818-11259840 AAAAGGAAGCCAAAAGATGCTGG + Exonic
950932406 3:16803606-16803628 CAGAGGAAGCTTGAGGATGAGGG + Intronic
950970418 3:17181209-17181231 CAAATGATGCAAAACGATGCTGG - Intronic
951251976 3:20404470-20404492 AAGAGGATGCAAAAGGATCAAGG + Intergenic
952808046 3:37375645-37375667 CAGAGAAAGAAAAAGGTTTCTGG - Intergenic
953469438 3:43154592-43154614 CTGTGGAAGGAAAGGGATGCAGG - Intergenic
953856770 3:46505347-46505369 TAGAGGGAGCACTAGGATGCAGG - Intergenic
954631742 3:52051516-52051538 CAGATGACCCAAGAGGATGCAGG - Intronic
954834734 3:53455992-53456014 CTGAGGAAGAAAAAAGATCCAGG + Intergenic
955092863 3:55769489-55769511 CAGAGGATGCAAAGGTTTGCAGG + Intronic
955349821 3:58185121-58185143 CTGAGGAAGGCCAAGGATGCTGG - Intergenic
955399482 3:58581266-58581288 CAGAGGAACCCAAAGGAAGGGGG + Intronic
955584460 3:60461772-60461794 CAGAGGCAGGATAAGGATGGGGG + Intronic
955611302 3:60760176-60760198 GAGAGGAACCCAAATGATGCAGG + Intronic
956067648 3:65414026-65414048 GAGAGAAAGCAAAAGGATCTTGG - Intronic
956865701 3:73366742-73366764 CAGATGACGCAAATGGATACAGG - Intergenic
956914189 3:73853452-73853474 CAGAGGAACCAAAAGGAAAAAGG + Intergenic
957646048 3:82929009-82929031 GAGAGGAAGCAAAAATATGCAGG + Intergenic
958830721 3:99085491-99085513 TAGAGGAAGCAGAAGTTTGCTGG - Intergenic
958842839 3:99229039-99229061 CAGAGGAATCAAAAGAAGGAAGG + Intergenic
959474511 3:106792258-106792280 CAGAGGAAACAAAAGAATAAAGG + Intergenic
960156181 3:114298945-114298967 AAGTGGAAGCAAGAAGATGCAGG - Intronic
961533409 3:127554426-127554448 CAGAGGAAGAAAGACCATGCAGG - Intergenic
961581371 3:127886078-127886100 CAGAGAAAGCTAAATGATACAGG - Intergenic
963765796 3:149334845-149334867 CAGAGGTGGTAAAAGGAAGCTGG + Intergenic
964876490 3:161373107-161373129 CAGAGGAAGCTAAAGGTAGATGG + Intergenic
965720880 3:171660938-171660960 GAGATGAAGCAAAATGATTCTGG + Intronic
965781321 3:172289205-172289227 CAGACAAAGCCAAGGGATGCAGG - Intronic
966636341 3:182138165-182138187 TAGAGGAAGGAAAAGGAGGGAGG + Intergenic
968639412 4:1704622-1704644 CAGGGGAAGCACGAGGTTGCTGG - Intronic
969050057 4:4366319-4366341 CGGAGGAAGAGAAAGGAGGCTGG + Intronic
969537786 4:7767270-7767292 AAGAGGGAGCAAAAGGGAGCGGG + Intronic
970016128 4:11514743-11514765 CAGAAGAAGAAAAGAGATGCAGG + Intergenic
971375246 4:26050907-26050929 CAGTGGAAGCATGAGGAAGCTGG - Intergenic
971914018 4:32843677-32843699 AAGAGCAAGAAAAAGGATGGAGG + Intergenic
972663566 4:41142084-41142106 AAGATGGAGGAAAAGGATGCTGG + Intronic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
973755210 4:54067355-54067377 CAGAGCCAGCAAAAGGGTGTGGG + Intronic
975890143 4:79017778-79017800 CAAAGGAATCAAAAGGAAGTTGG - Intergenic
976352065 4:84070867-84070889 GAGAGAAAAGAAAAGGATGCTGG + Intergenic
976870602 4:89788757-89788779 GAGAGGCAGCCAAAAGATGCTGG - Intronic
977219203 4:94319335-94319357 AACAGGAACCAAAAGCATGCAGG - Intronic
978386465 4:108180450-108180472 AAGAGGAAGCAAAAAGAAGAGGG + Intergenic
981871743 4:149495130-149495152 CAGAGAAAGAAAAAGAATGAAGG + Intergenic
982134390 4:152259437-152259459 CAGAGGAAGGAGAGGGGTGCAGG - Intergenic
984424135 4:179562313-179562335 AAGAGGAGGTTAAAGGATGCTGG - Intergenic
984542694 4:181060358-181060380 CAGAGGGAAGAAAAGGATGGGGG - Intergenic
984949283 4:184994744-184994766 GAGAGGAAGAAGACGGATGCAGG + Intergenic
986211595 5:5678730-5678752 GAGAGAAAGGAAAAGGATGAGGG + Intergenic
986266634 5:6196706-6196728 TAGAGGCAGCAAGAGGATGGCGG + Intergenic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
986999404 5:13644340-13644362 CATAGTAAGAAAATGGATGCTGG + Intergenic
987261221 5:16205404-16205426 CAAAGGAAGAAAATGGAAGCTGG - Intergenic
987305174 5:16630737-16630759 CAGAGCATGCAAAAGCATGAGGG + Intergenic
987499368 5:18687506-18687528 CAGAGGATGAAATAGGAGGCTGG - Intergenic
987975748 5:25012817-25012839 CAGAGGAAGCAAAAGAGAGATGG + Intergenic
988690439 5:33566720-33566742 CAGAAGAAGAAAAAGGATTATGG - Intronic
989439271 5:41451074-41451096 CAGAGGAAATAAATGGATTCTGG + Intronic
990153964 5:52853159-52853181 CAGAGCAACCAAAAAGATGTGGG + Intronic
992323636 5:75638822-75638844 CAGAGGAACAAAAAGGAAACTGG - Intronic
992370958 5:76143598-76143620 CCCAGGAAGCAATAGGATCCAGG + Intronic
992632324 5:78693933-78693955 CAGAGAAAGCAAAATAGTGCGGG + Intronic
993069100 5:83135618-83135640 CACAGGAAGCAAAAAAATGGTGG - Intronic
993090512 5:83420644-83420666 CAGAGGAAGCAGAGGGCTGTGGG + Intergenic
993711129 5:91226342-91226364 CAGAAGAAGGAATAAGATGCTGG - Intergenic
995309264 5:110692512-110692534 CACAGGAAGCGCAAGGAGGCAGG + Intronic
996706073 5:126499962-126499984 CAGAGGAGGCATAATGAGGCTGG + Intergenic
996760518 5:126982218-126982240 CTGAGGATGCAACAGGAAGCAGG - Intronic
998653278 5:144145004-144145026 CTGAGGCACCAAAAGGTTGCTGG + Intergenic
999328774 5:150659200-150659222 CACAGGAGGCAGAAGAATGCAGG - Intronic
999574036 5:152954134-152954156 TAGAGGAAGTAAAAGAATGTGGG - Intergenic
999907296 5:156155913-156155935 AAGAGGAAACAGAAGGTTGCAGG + Intronic
1000128027 5:158266508-158266530 CATAGAGAGCAAGAGGATGCTGG + Intergenic
1000644398 5:163743247-163743269 GGGAGGAAACAAAAGGAGGCAGG + Intergenic
1000700190 5:164439915-164439937 CAGAGGAAGGTAAAGGATTTAGG + Intergenic
1001084523 5:168691033-168691055 CTGAGGAAGGAAAAGGCTGCTGG - Intronic
1001553388 5:172620275-172620297 CAGAGGAAGCAGAGGGATATTGG - Intergenic
1001972966 5:175971552-175971574 TAGAGAAAGCAAATGGAGGCTGG - Intronic
1002213411 5:177611543-177611565 CAAGGGAAGCAACAGGCTGCAGG - Intergenic
1002244472 5:177872237-177872259 TAGAGAAAGCAAATGGAGGCTGG + Intergenic
1002257475 5:177968797-177968819 GAGAGGAAGCAAGAGGGTCCAGG + Intergenic
1002901022 6:1409923-1409945 CAGAGGAAGCGCAAGGACACTGG + Intergenic
1003821686 6:9905234-9905256 CAGAAGAAACAAGAAGATGCGGG - Intronic
1004129187 6:12902661-12902683 AAGAGGAAGAAAATGAATGCTGG - Intronic
1004364350 6:14999348-14999370 CAGAGGAAGGAAAAGCATTCAGG - Intergenic
1004455292 6:15786154-15786176 CTGAGAAAGGAACAGGATGCAGG - Intergenic
1006177054 6:32128765-32128787 CAGGGGAAGAACCAGGATGCAGG - Exonic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1008179953 6:48316094-48316116 CAGAGAAACCAAGAGAATGCTGG + Intergenic
1008428578 6:51388086-51388108 CAGAGCAAACAAAGGGATGAAGG + Intergenic
1008902582 6:56638505-56638527 CAGAGGAAAAAAAATGATGCTGG - Intronic
1008950945 6:57158611-57158633 TAGAGGAAGCAATGGGAGGCAGG - Intronic
1009059731 6:58384512-58384534 TAGAGGAAGAAAAATGAAGCAGG + Intergenic
1009873222 6:69473904-69473926 CAGAGTGAGAAAAAGGAAGCAGG - Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010080488 6:71855983-71856005 GAGAGGAAGAAAAAGCAAGCAGG - Intergenic
1010320344 6:74501085-74501107 CAGAAGAAGTAAAAGGATATGGG - Intergenic
1012670085 6:102033373-102033395 GAGAGGAAGCAAGAGCATGCTGG - Intronic
1013052162 6:106546903-106546925 CAGAGGAAGCAAAAGGATGCTGG + Intronic
1013279572 6:108622977-108622999 CAGTGGAAGCAACAGGAGGGTGG + Intronic
1013762006 6:113529793-113529815 CAGAGTAAGAAAAAGTATGGGGG - Intergenic
1015233078 6:130938901-130938923 CAGAGGAAGAAAAAGTAGGCAGG + Intronic
1015373334 6:132480851-132480873 CAGAGCAAGAAAAAGAATACTGG - Intronic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1017577232 6:155818459-155818481 CAGAGAAAGCAAGAGGAAGGAGG + Intergenic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018804298 6:167246986-167247008 GAGAGTTAGCAAAAGCATGCAGG - Intergenic
1019771681 7:2887233-2887255 CAGAGGAAAAAAAAGGAAGAAGG + Intergenic
1021610584 7:22454154-22454176 AAGAGAAAGCTAAAGAATGCAGG + Intronic
1021625439 7:22588689-22588711 GAGAGGAAGAAAAAAGATCCTGG - Intronic
1021991271 7:26143593-26143615 AATAGGAATCAAAAGCATGCAGG + Intergenic
1022396303 7:29990086-29990108 AAGAGGCGCCAAAAGGATGCTGG - Intronic
1022503458 7:30896669-30896691 GAGGGGAGGCAAAAGGAGGCAGG - Intergenic
1022813333 7:33890261-33890283 CAGCTGAAGTCAAAGGATGCAGG + Intergenic
1022849061 7:34241307-34241329 CACAGGAAGGGAAAGGATCCAGG - Intergenic
1023155582 7:37248420-37248442 CAGAGAAAGCAAAAGGAGTGAGG + Intronic
1023565022 7:41515616-41515638 GAGAGGAAGAAAAATGATGTAGG + Intergenic
1023616963 7:42029601-42029623 GACAGGAGGCAAAAGGATGCAGG - Intronic
1023882282 7:44327106-44327128 CTGAGGAAGCAGAGGGATCCTGG + Intronic
1024086244 7:45894100-45894122 CAGAAGTGACAAAAGGATGCTGG - Intergenic
1024995689 7:55271734-55271756 CAGAGGCAGCCAGAGCATGCTGG + Intergenic
1026389731 7:69888351-69888373 GAGAGGAAACAAGAGGATGGGGG + Intronic
1026521073 7:71118707-71118729 CAGAGGAAGCCACAGGTTGGGGG - Intergenic
1026689573 7:72540244-72540266 AAGAGGAAGAAAAAGAAGGCAGG + Intergenic
1028876302 7:95827110-95827132 CAGAGTAAACAAAGGGATGCAGG + Intronic
1030362665 7:108611098-108611120 GAGAGAAAGCACAAGGATTCTGG - Intergenic
1031100424 7:117472999-117473021 TAGAGGAATGAAAAGTATGCAGG - Intronic
1031483618 7:122304950-122304972 CAGAGGAAGCAAAAGGGGGGTGG - Intronic
1032074296 7:128829342-128829364 CAGGGCAAGCCAAAGGCTGCAGG - Intergenic
1032166303 7:129547733-129547755 CAGAGGAAACAAAAAGGTGGAGG - Intergenic
1033416468 7:141166066-141166088 CTGAGGAAGAAAAAGCAGGCTGG + Intronic
1034283455 7:149869136-149869158 CAGTGGAATCAAAAGGACTCAGG + Intergenic
1034409396 7:150931839-150931861 CAGGGGAGAGAAAAGGATGCTGG + Intergenic
1035769165 8:2133151-2133173 CAGCAGTAGCAAAAGGCTGCTGG + Intronic
1036704184 8:11034460-11034482 CACATGAAGCACAAGGATGGGGG + Intronic
1036967924 8:13320897-13320919 GAGAGGAAGCAAAAGACAGCTGG - Intronic
1037294180 8:17383308-17383330 CAGAGGGAGCAAGAGGAGGAAGG + Intronic
1037342746 8:17863879-17863901 CAGAAGAAGCTATAGGATGGTGG + Intergenic
1037636320 8:20703863-20703885 CAGAGGAAGTAGAGAGATGCAGG + Intergenic
1037660562 8:20922907-20922929 CAAAAGAAGAAAAAGGATGGAGG - Intergenic
1038003106 8:23407137-23407159 CAGATGAAACAAAATGATGGCGG + Intronic
1039316452 8:36378127-36378149 CAGAGCAAGTAAAATGATTCAGG - Intergenic
1039634399 8:39147623-39147645 CAGAGGAAGAAGGTGGATGCTGG - Intronic
1039907314 8:41796609-41796631 CAGAGGAAGCAATACTAAGCGGG - Intronic
1040627864 8:49172579-49172601 AAAAGGAAGCAGAAGGAAGCTGG - Intergenic
1040684978 8:49860967-49860989 CAGATGAAGCTGAAAGATGCTGG + Intergenic
1042559472 8:70062259-70062281 CAGAGCAAGCAACAGAATGAGGG - Intronic
1043817697 8:84823412-84823434 GAGAGGAAATAAAAGGCTGCAGG + Intronic
1043974366 8:86568205-86568227 CAGAGGCAGCGGAAGGATTCTGG - Intronic
1045317704 8:101057701-101057723 CAGAGGAAGCAATGAGATGCAGG - Intergenic
1045431095 8:102115762-102115784 CAGAGGAAGGCTAAGGATGCTGG - Intronic
1046993429 8:120487235-120487257 CACTGGAAGCAAAATGAAGCTGG - Intronic
1047578137 8:126181228-126181250 CAGTGGAAGCTAAAGAAAGCAGG + Intergenic
1047673565 8:127174786-127174808 GAGAGGAAGCAAAAGGGAGGGGG + Intergenic
1047719257 8:127623883-127623905 CAGAGGAAGCCACAGGATGACGG - Intergenic
1048115486 8:131517197-131517219 GAGGGTAAGCAGAAGGATGCAGG - Intergenic
1048341038 8:133538585-133538607 GAGAGGATGCAAAAGGCTGAGGG + Intronic
1048435130 8:134409272-134409294 CTGAGGAAGCAGATGGATGTTGG + Intergenic
1048625177 8:136177342-136177364 CAGATGAAGAAACAGAATGCAGG - Intergenic
1048727177 8:137400130-137400152 CAGAGGGAGGACAAAGATGCTGG + Intergenic
1049171137 8:141161400-141161422 CTGGGGAAGCAATAGCATGCAGG - Intronic
1049563936 8:143327687-143327709 CAGAGGGAGAATGAGGATGCCGG + Intronic
1050043414 9:1519280-1519302 GAGAGGGAGCAGGAGGATGCTGG + Intergenic
1051014209 9:12455832-12455854 CAGAAGGAGGAAATGGATGCTGG + Intergenic
1051544947 9:18263401-18263423 CGGAGGAAGCAACAGGAGCCAGG - Intergenic
1052975736 9:34408632-34408654 CAGAGGAGGCAAAGGGTTGTGGG - Intronic
1058170460 9:101674349-101674371 AAGAGGAAGCAAAAGAAAGAAGG - Intronic
1058307253 9:103459485-103459507 CAGATGCATCCAAAGGATGCAGG + Intergenic
1058565714 9:106283008-106283030 TAGAGAAAGCTAAAGGGTGCTGG - Intergenic
1059327287 9:113511817-113511839 CAGAGAAGGCAAAACCATGCAGG - Intronic
1059695958 9:116730716-116730738 CAGAAGAGGCAGAATGATGCAGG + Intronic
1060997362 9:127882774-127882796 CGCAGGAAACAAATGGATGCAGG + Intergenic
1062043073 9:134412907-134412929 CACAGGAAGCAAAGGCAGGCAGG - Intronic
1062174781 9:135155264-135155286 CAGAGGAACAATATGGATGCAGG + Intergenic
1062209777 9:135357213-135357235 CAGAGAAAGCCAAGGGATCCAGG + Intergenic
1062300619 9:135865955-135865977 CAGAGGAAGAAAAAGGCTAATGG + Intronic
1062377897 9:136272178-136272200 CAGCAGAAGGAAAAGGATGCGGG + Intergenic
1185591381 X:1279707-1279729 AAGAGGAAGTAAAAGCATGTAGG - Intronic
1185838847 X:3369889-3369911 CAGCGGGAGCCAGAGGATGCGGG - Intergenic
1187265706 X:17731068-17731090 CAGAGAAAGCAAGTGGATGGAGG - Intronic
1187447672 X:19373147-19373169 GAGAGGAAGGAAAAGGAGGAAGG + Intronic
1187743890 X:22387511-22387533 GAGAGGAGGAAAAATGATGCTGG - Intergenic
1188266040 X:28076009-28076031 CAGTGAAAGCAAAAGGAGACAGG + Intergenic
1188963293 X:36519607-36519629 TAGAGGAAGCAATACCATGCAGG - Intergenic
1189197089 X:39161989-39162011 CAGAGGAAGAAAAATGAAGTTGG - Intergenic
1191635094 X:63367630-63367652 CCGAGGAAGCACAAGGAGTCAGG + Intergenic
1192177510 X:68895165-68895187 CTGAGGAAGCATAATCATGCTGG - Intergenic
1192225255 X:69222996-69223018 CAGAGTGAGCAAAATGAGGCAGG + Intergenic
1192591020 X:72359470-72359492 TAGAGGAGGCAAGAGAATGCAGG + Intronic
1193638578 X:83984186-83984208 CAGAGGAAGTAAACAGATACTGG + Intergenic
1195045305 X:101050036-101050058 CAGAGGAGGGACAAGGAAGCTGG + Intronic
1195322618 X:103732055-103732077 CACACGCAGCAAAAAGATGCAGG - Intergenic
1195660441 X:107372644-107372666 CAGATGAAACAAATGGTTGCAGG - Intergenic
1195701756 X:107710939-107710961 CAGAGGTGGCAAAAGCAGGCAGG + Intergenic
1195931653 X:110083467-110083489 CAGAGAAAGCAAAAGAAATCTGG - Intronic
1197147781 X:123188168-123188190 CAGAGAAAGCAACAGGCAGCTGG - Intronic
1198092873 X:133349265-133349287 CGGAGAAAGCAAAAGGAAGAAGG + Intronic
1199627594 X:149755129-149755151 CAGAGGATGGGAAAGGAAGCTGG - Intergenic
1199684647 X:150255273-150255295 GTGAGGAAGCACAAGGAAGCTGG - Intergenic