ID: 1013052447

View in Genome Browser
Species Human (GRCh38)
Location 6:106549392-106549414
Sequence TCATGGCCACAGGTGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 241}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013052447 Original CRISPR TCATGGCCACAGGTGGAGCC AGG Intronic
900091052 1:920899-920921 CCGGGGCCACAGGTGCAGCCAGG - Intergenic
900145323 1:1156736-1156758 TCAGGGCCTCAGGTGGAGGTGGG + Intergenic
900394785 1:2448785-2448807 TCTTGGTCACCTGTGGAGCCAGG - Intronic
900402384 1:2477905-2477927 CCCTGGCCACAGGTGGCTCCTGG - Intronic
901125533 1:6925916-6925938 TCAGGGTTACAGCTGGAGCCGGG - Intronic
901916210 1:12502507-12502529 TCAGGGCCATAGGTGGACCTGGG + Intronic
904003436 1:27351075-27351097 TCATGGCCCCAGGCGAAGCCCGG + Intronic
905169065 1:36099091-36099113 CCAGGGCCCCAGGGGGAGCCTGG - Exonic
905346849 1:37317228-37317250 TGCTGGCCACTGATGGAGCCTGG + Intergenic
905420728 1:37841656-37841678 TTATAGCCACAGTTGGAGCCTGG - Intronic
905694293 1:39963377-39963399 TTGTAGCCACAGCTGGAGCCTGG - Intronic
906068072 1:42996460-42996482 TGATGGCCACATCTGGTGCCAGG + Intergenic
906325700 1:44843926-44843948 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
906709985 1:47922294-47922316 TCTTGGCCTCTTGTGGAGCCTGG - Intronic
906950036 1:50326986-50327008 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
907039948 1:51250603-51250625 TTGTAGCCACAGCTGGAGCCTGG + Intronic
911856336 1:102881731-102881753 TCATGGCCAAAGGAGAAACCAGG - Exonic
915644994 1:157264117-157264139 TCATGGCCAAAGGTAGACACAGG + Intergenic
916102801 1:161407060-161407082 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
918706281 1:187666765-187666787 CCATGGCCACAGGGGGAGTCAGG + Intergenic
919548214 1:198949778-198949800 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
920010516 1:202864037-202864059 TTATGGCCACGGGTGGTGACTGG + Intergenic
920502272 1:206492918-206492940 ACATGGACACAGGTGGGTCCCGG - Exonic
1067562756 10:47315277-47315299 CCATGCCCACAGCTGGACCCAGG - Intergenic
1068116212 10:52740239-52740261 ACATGGGCAGAGCTGGAGCCTGG + Intergenic
1070036642 10:72731624-72731646 TGATGGCCACAGGTGTAGAGGGG - Intronic
1070403140 10:76070939-76070961 TCCTTGCCACTGATGGAGCCAGG + Intronic
1070618150 10:77985323-77985345 TCTAGGGCACAGATGGAGCCAGG - Exonic
1071566306 10:86673086-86673108 TCCTGGGCAGAGGTGGAGCCTGG - Intronic
1073033881 10:100549492-100549514 TCAGGGCAACTGGTGGAGCATGG + Exonic
1074879910 10:117647713-117647735 TCATGGCCAGAGGTCCAGCCTGG - Intergenic
1075514819 10:123100383-123100405 TCTCAGCCACAGGTGGATCCAGG - Intergenic
1075549484 10:123381650-123381672 TCAGGGCCACAGGAGGAGCAAGG + Intergenic
1076229463 10:128808062-128808084 ACGTGGCCTCGGGTGGAGCCTGG - Intergenic
1078330712 11:10417060-10417082 TCCTGGGCACAGCTGGAGGCAGG - Intronic
1080825778 11:35847777-35847799 TCATGGCTACAGGGGAAGCCAGG - Intergenic
1081998486 11:47378966-47378988 GCAGGGCCACAGGAAGAGCCAGG - Intergenic
1083286280 11:61661208-61661230 ACATGGCCAGAGGGGGAGCAAGG + Intergenic
1083348617 11:62011756-62011778 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1083348751 11:62012504-62012526 TCACGGCCAGGGTTGGAGCCAGG - Intergenic
1083610763 11:64003116-64003138 TTCTGGCCACAGGTGGAGGAAGG - Intronic
1084606199 11:70173557-70173579 CCATGGCCAGAGGTGGAGCAAGG + Intronic
1085040611 11:73324307-73324329 TCCTGGCACGAGGTGGAGCCTGG + Intronic
1086515176 11:87603787-87603809 AGATGGACACAGGTGGAGCAGGG + Intergenic
1088509589 11:110560942-110560964 CCATGGCCACAGGGGGCACCAGG - Intergenic
1089062891 11:115640551-115640573 TCAGGGACAGCGGTGGAGCCAGG - Intergenic
1089792635 11:120955748-120955770 TCATTGGCTCAGGTGGGGCCTGG - Intronic
1090226536 11:125075315-125075337 ATATGGCAACAGGTGGAACCCGG + Intronic
1091037013 11:132243746-132243768 CCTGGGCCACTGGTGGAGCCAGG + Intronic
1091349821 11:134884164-134884186 GCAGGGACACAGATGGAGCCGGG - Intergenic
1091721901 12:2820074-2820096 TCATGCCCACAGATGGAGATGGG + Exonic
1091752337 12:3030828-3030850 TCATGGCCACGTGCGTAGCCAGG + Intronic
1095944556 12:47746573-47746595 TCATGCCCACAGGTAGAGCCTGG - Intronic
1096525550 12:52207980-52208002 TAAAGGCCACACGTGGAGGCTGG + Intergenic
1097687002 12:62700416-62700438 GCTTTGCCACAGGTGGAGACAGG - Intronic
1098897794 12:76083903-76083925 TCATGGCCACTGGCTGGGCCTGG - Intronic
1099783986 12:87237141-87237163 TCATGGCAATAGGGGGAGCAGGG - Intergenic
1100543630 12:95580957-95580979 TCATGACCAGAGCTGGAGCACGG - Intergenic
1100739056 12:97571062-97571084 TCATGGCCACACATCTAGCCAGG - Intergenic
1104468792 12:129011688-129011710 TCATTACCACAGGTGGGGTCTGG - Intergenic
1104810802 12:131619255-131619277 TCTTGGGCACAGGAGGAGCGGGG + Intergenic
1105727145 13:23174956-23174978 CCATGGTCACAGGTGGAGGATGG + Intergenic
1106128816 13:26922514-26922536 TCATGGACACCGGGAGAGCCAGG - Intergenic
1111318170 13:86587390-86587412 TCATTGTTAAAGGTGGAGCCTGG + Intergenic
1111624638 13:90768962-90768984 TCATCACCAGAGGTGGAGGCAGG - Intergenic
1112163730 13:96895696-96895718 ACATGGAGCCAGGTGGAGCCAGG + Intergenic
1114455275 14:22849740-22849762 TCATGGGCCCAGCTGGTGCCAGG - Intergenic
1114598719 14:23936273-23936295 TCATGGCCTCCGGTGGATTCTGG + Intergenic
1117498332 14:56327809-56327831 TCATTCCCACACTTGGAGCCAGG + Intergenic
1119403082 14:74377728-74377750 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1120331776 14:83102541-83102563 TCAGGGACACAGATGGAGCTGGG + Intergenic
1122183830 14:99974332-99974354 TAATAGCCATAGCTGGAGCCTGG + Intronic
1122924367 14:104892857-104892879 TGCTGGCCAGAGGTGGGGCCTGG - Intronic
1202862365 14_GL000225v1_random:90602-90624 GCACTGCCGCAGGTGGAGCCAGG + Intergenic
1123939789 15:25211271-25211293 TCATGGCCAACCGAGGAGCCTGG - Intergenic
1124002492 15:25770641-25770663 TTAGGCCCAGAGGTGGAGCCAGG + Intronic
1124642210 15:31402667-31402689 ACAGAGCCCCAGGTGGAGCCTGG + Intronic
1124718400 15:32089391-32089413 TGATGGCCTCATGAGGAGCCTGG - Intronic
1125172476 15:36781435-36781457 TCAGGGTCACACTTGGAGCCTGG + Intronic
1129477123 15:75792971-75792993 ACATGGCCAGAGCTGGTGCCAGG + Intergenic
1129512524 15:76135360-76135382 ACATGGCCAGAGATGGTGCCGGG + Intronic
1130353534 15:83110750-83110772 TCATCCCCACAGGAGGAGCCTGG + Intronic
1130548241 15:84871992-84872014 TCAGAGCCACAGGTGTAGACAGG + Exonic
1131327619 15:91463535-91463557 TCATGGCGGCAGGTGAAGGCAGG - Intergenic
1131558665 15:93420627-93420649 TCATGGCGGAAGTTGGAGCCGGG + Intergenic
1132286036 15:100663261-100663283 TCAGGGCAACAGATGGAGCCAGG + Intergenic
1132613040 16:827165-827187 TTATGAGCAGAGGTGGAGCCAGG - Intergenic
1133304813 16:4802306-4802328 GCGCGGCCCCAGGTGGAGCCAGG + Intronic
1133317405 16:4893179-4893201 TCAGGAGCACAGGTGGGGCCGGG - Intronic
1133880096 16:9773548-9773570 TCTTGGGAACAGATGGAGCCTGG + Intronic
1134263398 16:12672332-12672354 TAATGTCCACAGGTACAGCCCGG - Intronic
1134450025 16:14357703-14357725 TGATGGACAGAGGAGGAGCCTGG - Intergenic
1135331950 16:21567763-21567785 TAAAAGCCACAGCTGGAGCCAGG - Intergenic
1135937284 16:26792069-26792091 ACATGCCCACATGTAGAGCCTGG - Intergenic
1137540817 16:49360413-49360435 TCATCACCACAGCTGGAGCAGGG - Intergenic
1138484793 16:57332378-57332400 TTGTAGCCACAGTTGGAGCCTGG + Intergenic
1140235220 16:73152926-73152948 TCCTGACCACAGGCTGAGCCGGG + Intergenic
1140343408 16:74188268-74188290 ACATGGCCAGAGTGGGAGCCGGG + Intergenic
1141000185 16:80300487-80300509 TCCTGGCCCCTGCTGGAGCCAGG - Intergenic
1141749311 16:85947645-85947667 TGCTGCCCACGGGTGGAGCCAGG + Intergenic
1141813267 16:86390939-86390961 TCAAGGTCACAGGCAGAGCCAGG - Intergenic
1142276815 16:89123157-89123179 TCTTGGCCCCTGGTGGAGCCAGG - Intronic
1142551654 17:744315-744337 TCATGGCCAGAGGCAGAGCCAGG + Intergenic
1143501484 17:7342040-7342062 TCATGGGCTCTGGTGGACCCAGG - Exonic
1144144836 17:12387472-12387494 GTCTGGGCACAGGTGGAGCCTGG + Intergenic
1144825996 17:18106024-18106046 TTCAGGCCACAGGTGGGGCCAGG + Intronic
1144863966 17:18323224-18323246 ACATGGGCAGAAGTGGAGCCTGG + Intergenic
1146899567 17:36574464-36574486 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1146978800 17:37140613-37140635 TTGTAGCCACAGTTGGAGCCTGG + Intronic
1147217052 17:38906875-38906897 TCATGGGCACAGGTAGAGTGTGG + Intronic
1147844303 17:43394157-43394179 TCAAGGCCTAGGGTGGAGCCAGG - Intergenic
1148377168 17:47159196-47159218 TTGTAGCCACAGCTGGAGCCCGG + Intronic
1149166236 17:53756994-53757016 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1149478949 17:56986130-56986152 TCATAGCAATAGGTGCAGCCGGG - Intronic
1150388151 17:64776375-64776397 TTAGGGCCACAAGTGGGGCCAGG + Intergenic
1150665122 17:67127223-67127245 ACATGGCCACAGGCGGACTCGGG + Intronic
1151192297 17:72407412-72407434 TCTTTGCCACAGGTGTTGCCAGG + Intergenic
1151404416 17:73877481-73877503 TCCTGGCTACAGCTGGAGCAAGG + Intergenic
1152907524 17:82977005-82977027 TCAGGGCCCCAGGTGGCCCCAGG + Intronic
1153107958 18:1549993-1550015 TTTTGGCCACAGCTGGAGCTGGG - Intergenic
1156338541 18:36189918-36189940 GAATGGCTACTGGTGGAGCCAGG + Intronic
1156338573 18:36190164-36190186 TCAAGGCCACAGGTGAGACCTGG - Intronic
1156949112 18:42871697-42871719 TCATGGCCAAAGGTGTAGAAGGG + Intronic
1157359709 18:46965592-46965614 TCATGGCCACCGTTGGGGGCGGG - Intronic
1157361298 18:47025109-47025131 TCATGGCCACCGTTGGGGGCGGG - Intronic
1157362291 18:47031025-47031047 TCATGGCCACCGTTGGGGGCGGG - Intronic
1159601345 18:70431098-70431120 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1160298317 18:77657543-77657565 TCCTGGCCAGAGGGGTAGCCTGG - Intergenic
1160844933 19:1162012-1162034 GCACGGCCACAGATGGCGCCTGG + Intronic
1162674093 19:12285158-12285180 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1163104245 19:15114478-15114500 GCATGGACACAGGGGTAGCCTGG + Exonic
1163177922 19:15577415-15577437 TCATGGCCTGAGGGGCAGCCAGG - Intergenic
1163192144 19:15685052-15685074 TCATGGCCTGAGGAGCAGCCAGG - Exonic
1163296061 19:16413549-16413571 TTGTAGCCACAGCTGGAGCCTGG - Intronic
1164559070 19:29276140-29276162 TGATGGAGACAGCTGGAGCCTGG - Intergenic
1165017107 19:32889357-32889379 CCCTGGTGACAGGTGGAGCCAGG + Intronic
1166231517 19:41427761-41427783 TCCTGGCCATGGGTGCAGCCGGG - Intronic
1166863815 19:45824325-45824347 TACTGGGCAGAGGTGGAGCCTGG - Intronic
1166961135 19:46496350-46496372 TCTTGCTCACAGGTGGTGCCTGG - Exonic
1167019676 19:46863757-46863779 TTATGGCCACAGTTGGACCTAGG + Intergenic
1167083022 19:47290184-47290206 TGATGGCTTCAGGTGGAACCTGG + Intronic
1167748302 19:51365757-51365779 CCATAGCCACAGGGTGAGCCAGG - Intronic
926271063 2:11366378-11366400 TCATGGGCCCAGGTTCAGCCTGG - Intergenic
926735541 2:16070729-16070751 TCAAGGCCACAGGGGGTGCCTGG - Intergenic
927894721 2:26774369-26774391 TCATGGCCGGGGGTGGCGCCTGG - Intronic
928115658 2:28543646-28543668 TCAAGGCCCAAGGTGGTGCCTGG + Intronic
928129595 2:28640243-28640265 TGCTGGCCACAGGTTGGGCCTGG + Intronic
931160281 2:59682444-59682466 TGATGGCCACAGGTGAAGTCTGG + Intergenic
934854186 2:97718714-97718736 ACGTGGCCGCAGGTGCAGCCTGG - Intronic
934883644 2:98005739-98005761 TCATGGCCTCAGGAGGCTCCTGG - Intergenic
935223719 2:101035955-101035977 TCATGGACACAGGAACAGCCCGG - Intronic
938140693 2:128792053-128792075 CCAAGGCCACAGGTGGACCTGGG + Intergenic
939093124 2:137801768-137801790 TCATGGGTATAGGTGGAGTCAGG - Intergenic
939181654 2:138810096-138810118 TCCTGGCCACAGAAGGAGCCAGG - Intergenic
940859501 2:158757444-158757466 TCCTGGCCTCAGGTGGCACCTGG - Intergenic
946190007 2:218003094-218003116 TCAAGGCCACCGGTGGAGCCTGG - Intergenic
948612785 2:239180301-239180323 TCATGGTCACAGGCGGTGCAGGG + Intronic
948634966 2:239329087-239329109 TCCTGGCCCCAGATGGAGGCAGG + Intronic
948730217 2:239958486-239958508 TCCAGGCCACAGGTGGACCCAGG - Exonic
948835354 2:240623729-240623751 TCCTGTACACAGGTGGAACCTGG + Intronic
1169022725 20:2341481-2341503 TCCTGGCCACAAGAGGAGCGTGG - Intergenic
1173730548 20:45325462-45325484 TAATGGCCACTGGTGCAGCAAGG + Exonic
1175096982 20:56548969-56548991 ACATGGCCAGAGGAGGAGCAAGG - Intergenic
1175672660 20:60919373-60919395 TCATGGTCATAGGTGGGACCTGG - Intergenic
1176866963 21:14059125-14059147 TCCAGGGCAGAGGTGGAGCCAGG + Intergenic
1178637742 21:34319775-34319797 AGATGGCAACAGGTGGAGACGGG - Intergenic
1180046806 21:45310347-45310369 GCATGTCCACAGGTGGAGGTGGG + Intergenic
1180954762 22:19736727-19736749 TCAGGGCCACAGCTGGGGCCTGG + Intergenic
1181162626 22:20967160-20967182 TCCTGGCCACAGCTTGAGCTGGG + Intronic
1181625290 22:24118803-24118825 CCATGGCCCCTGGTGGAGCAAGG + Intronic
1181629774 22:24144581-24144603 TCATGGGCACAGGGGCAGCTGGG + Intronic
1181979250 22:26754160-26754182 TCCAGTCCACAGGTGGAGGCTGG - Intergenic
1184152039 22:42644948-42644970 TCATTGTCACACGGGGAGCCTGG - Intronic
1184915071 22:47563591-47563613 CCATGGTCCCAGGGGGAGCCGGG + Intergenic
1184980443 22:48091739-48091761 TCATGCCCACAGTTGGTGCAGGG - Intergenic
1185380396 22:50505143-50505165 CCTTGCCCACAGGTGGACCCAGG - Exonic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
951684150 3:25325738-25325760 TCATGGCCACTTGTGGAAGCAGG + Intronic
952505739 3:34005466-34005488 TGATGGGCACTGGTGCAGCCTGG + Intergenic
952549216 3:34457094-34457116 TCATGCCCACAAGTGGTGCATGG + Intergenic
954108956 3:48423762-48423784 ACGTGGCCACAGCTGCAGCCTGG + Exonic
954134213 3:48574711-48574733 TCATCCCCACAGGGGGAGCCGGG - Exonic
954154594 3:48678452-48678474 GCAAGGCCACTGCTGGAGCCAGG - Intronic
954642641 3:52110744-52110766 ACATGGCCCCAGGCAGAGCCAGG - Intronic
954665236 3:52248044-52248066 TCATGGACAGAGCTGGATCCTGG + Intronic
954806939 3:53226040-53226062 TCATGGCTACAGGTGGAGAAAGG - Intronic
954920500 3:54186898-54186920 TCATGGCCACACCTGGAGCTTGG - Intronic
957216164 3:77322138-77322160 TCATAGTCACGTGTGGAGCCTGG - Intronic
958616553 3:96500296-96500318 TCTTGGTCCCAGGTGGAGCATGG - Intergenic
959964184 3:112334953-112334975 TCATGGCCTCTGGTAGAGCCTGG + Intronic
963605078 3:147406362-147406384 TCCTGGCAACAGGTGGAGTGGGG - Intronic
968022493 3:195405845-195405867 ACATGGCCAGAGCAGGAGCCAGG + Intronic
968290011 3:197531929-197531951 ACACTGCCACAGGTGGAGACTGG - Intronic
969593255 4:8133682-8133704 GCATGGACCCAGGTGGAGCTGGG - Intronic
969882959 4:10190516-10190538 TGATGGGGAAAGGTGGAGCCTGG + Intergenic
971051254 4:22865207-22865229 ACATGGCCAAAGATGGAGTCAGG - Intergenic
972879850 4:43410046-43410068 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
973533820 4:51860779-51860801 TCAGTGCCAGAGGTGGGGCCTGG - Intronic
975448678 4:74499722-74499744 TTATGGGCTCAGGTAGAGCCAGG + Intergenic
978067434 4:104422668-104422690 TCCTTGCCACAGGTTGAGCAGGG + Intergenic
979515906 4:121609690-121609712 TCACGGCCAGTGGTGGAGGCAGG + Intergenic
985561329 5:587675-587697 TTGTGGCCAGAGCTGGAGCCGGG - Intergenic
987784005 5:22475102-22475124 TCTTGGCAAGAGGTGGAACCAGG + Intronic
988428607 5:31092913-31092935 GCATGGCCTGCGGTGGAGCCAGG - Intergenic
990169039 5:53027622-53027644 TCATGCCCACTGGTGGACACAGG + Intronic
992520592 5:77546239-77546261 TTGTAGCCACAGCTGGAGCCTGG - Intronic
997427904 5:133816841-133816863 TCATGGCACCAGGTGGCCCCAGG + Intergenic
998501275 5:142635130-142635152 GCAGAGCCACAGGGGGAGCCAGG - Intronic
999230472 5:150058906-150058928 TCAGGGTTAGAGGTGGAGCCTGG - Intronic
999615350 5:153417088-153417110 TGATGGCCATAGGAGAAGCCCGG + Intergenic
1000216059 5:159157614-159157636 TCATGGCTACAGGTAGAACTGGG - Intronic
1000415979 5:160984260-160984282 TCATGCCTACAGGAGGAACCAGG - Intergenic
1001424813 5:171616166-171616188 TCAGAGACACAGGTGGGGCCAGG + Intergenic
1003198818 6:3939868-3939890 TCAGCTCCACAGATGGAGCCTGG - Intergenic
1005989870 6:30896156-30896178 GCTTGGCCCCAGGGGGAGCCAGG + Intronic
1006177302 6:32130115-32130137 GCATGGTGACAGGAGGAGCCGGG + Exonic
1007669327 6:43538827-43538849 TTGTAGCCACAGCTGGAGCCTGG + Intronic
1013052447 6:106549392-106549414 TCATGGCCACAGGTGGAGCCAGG + Intronic
1013606334 6:111752547-111752569 TCCTGGCCACAGGAAAAGCCAGG + Intronic
1014558047 6:122856814-122856836 ACATGGCCACAGCAGGAGCAAGG + Intergenic
1019256459 7:55452-55474 TAATGGCCACAGGGTGAGCTTGG + Intergenic
1019285042 7:219166-219188 ACCTCGCCCCAGGTGGAGCCTGG - Intronic
1022607367 7:31828718-31828740 CAATGGCCACAGGTTGACCCAGG - Intronic
1023098553 7:36689154-36689176 CCATGTCCACAAGTGGAGACTGG - Intronic
1023186866 7:37541431-37541453 GCTTGGCCACAGGAGGAGTCAGG - Intergenic
1023684588 7:42721390-42721412 CCAGGATCACAGGTGGAGCCGGG - Intergenic
1023868885 7:44252227-44252249 TCACCGCCCCAGGTGGAGGCTGG - Intronic
1025834607 7:65082580-65082602 GCAGGGCCACAGGTGGACACAGG - Intergenic
1026059008 7:67009618-67009640 TAATGGCCACAGGCAGATCCAGG - Exonic
1026719080 7:72815424-72815446 TAATGGCCACAGGCAGATCCAGG + Exonic
1030839514 7:114330905-114330927 TCATAGCTACAGGAGGAGTCTGG - Intronic
1031665876 7:124481368-124481390 TTGTAGCCACAGCTGGAGCCTGG - Intergenic
1031820432 7:126494033-126494055 TCATGGCCACTGGGGAAGCATGG + Intronic
1032758127 7:134911284-134911306 ACATGGCAGCAGGTGTAGCCAGG + Intronic
1036920214 8:12845482-12845504 TGGTAGCCACAGCTGGAGCCTGG + Intergenic
1037963125 8:23114789-23114811 TCTTGTCCAGAGGTGGAGCGTGG + Intronic
1039080068 8:33725375-33725397 TCCTGGCCACAGGAGGAGATAGG + Intergenic
1039395226 8:37220013-37220035 TCCTGGCCACCGCTGGAGCTTGG - Intergenic
1039710321 8:40049647-40049669 TCATGGCAAAAGCTGGAGCAAGG - Intergenic
1043169277 8:76944394-76944416 TCATTGTTAGAGGTGGAGCCTGG + Intergenic
1044971409 8:97624208-97624230 TTGTAGCCACAGCTGGAGCCTGG + Intergenic
1045547700 8:103142845-103142867 TCACTGCAACAGGTGGGGCCTGG + Intronic
1045866177 8:106868132-106868154 TCTAGGACACAGGTGGAGGCTGG + Intergenic
1049172981 8:141173581-141173603 TCATGGCCACAGTTGAGTCCAGG - Intronic
1049487462 8:142874054-142874076 GTATGGCCACACGAGGAGCCTGG + Exonic
1049492247 8:142911652-142911674 GCATGGCCTCATGAGGAGCCTGG + Exonic
1049531272 8:143156824-143156846 TCATGGCCACTGCTGGGTCCTGG - Intergenic
1049687605 8:143945167-143945189 TCCCGGCCACCGGTGGGGCCAGG - Intronic
1057213843 9:93217632-93217654 TCAGGGCCACAGGAGGACCATGG - Intronic
1057214339 9:93219778-93219800 TGGTGGCAACAGGTGGAGCTGGG - Intronic
1057553273 9:96067479-96067501 TGATGGGCATGGGTGGAGCCTGG - Intergenic
1060822951 9:126671982-126672004 TCACGGCCACAGCTGGGGCTCGG - Intronic
1060901172 9:127259482-127259504 TCATGGCAACAGGGGGTCCCAGG + Intronic
1060975815 9:127764390-127764412 TCAGGGACACAGATGGAGGCAGG - Intronic
1061037557 9:128122071-128122093 TGATGGCGACAGGTAGAGCTTGG + Intronic
1061759866 9:132843162-132843184 CCATTGCTAGAGGTGGAGCCTGG + Intronic
1188436015 X:30159446-30159468 TCAGTGCCACATGTGGGGCCTGG - Intergenic
1189931707 X:46018974-46018996 TAATGGCCAAAGGTGGAGCAGGG - Intergenic
1192222846 X:69209150-69209172 TCCTGCCCACAGTTGGACCCAGG + Intergenic
1192496976 X:71622699-71622721 CCTTGACCACAGGTGGGGCCCGG - Intergenic
1199991284 X:152988987-152989009 TCCTGGCAAGAGGTGGATCCTGG - Exonic
1200031603 X:153301375-153301397 TCATGGCAACATGATGAGCCTGG + Intergenic
1200076804 X:153555223-153555245 CCATGGCCTCAGGGGGCGCCAGG + Intronic
1200152818 X:153959626-153959648 CCATTTCCACAGGTGGGGCCAGG + Intronic
1200887139 Y:8281220-8281242 TCTTGGTGGCAGGTGGAGCCAGG - Intergenic
1201653225 Y:16314569-16314591 ACATGGGTCCAGGTGGAGCCAGG + Intergenic