ID: 1013054491

View in Genome Browser
Species Human (GRCh38)
Location 6:106570222-106570244
Sequence TCTTCTCTGGAGTCTATGGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 579
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 561}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013054488_1013054491 15 Left 1013054488 6:106570184-106570206 CCATCTATTCAAGTGTGTTTCTA 0: 1
1: 0
2: 1
3: 23
4: 274
Right 1013054491 6:106570222-106570244 TCTTCTCTGGAGTCTATGGTAGG 0: 1
1: 0
2: 1
3: 16
4: 561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013054491 Original CRISPR TCTTCTCTGGAGTCTATGGT AGG Exonic
900037313 1:426446-426468 TTTTCTTTGGAGTATATTGTTGG + Intergenic
900058942 1:662187-662209 TTTTCTTTGGAGTATATTGTTGG + Intergenic
901273241 1:7970081-7970103 GCTACTCGGGAGGCTATGGTGGG + Intronic
902196236 1:14800590-14800612 GCTACTCTGGAGGCTAAGGTGGG + Intronic
902438001 1:16410355-16410377 GCTTCTCTGGAGGCTGAGGTGGG - Intronic
902590525 1:17470951-17470973 GCTGCTCTGGAGGCTGTGGTGGG - Intergenic
902831645 1:19017706-19017728 TCTACTCTGGAGGCTGAGGTGGG + Intergenic
903295152 1:22339062-22339084 ACTTCTCTGGACTCCAGGGTTGG - Intergenic
903407040 1:23106491-23106513 GCTTCTCAGGAGGCTAAGGTGGG + Intronic
903428093 1:23269836-23269858 TTTTCCCTAGACTCTATGGTAGG + Intergenic
905273513 1:36802239-36802261 TCTTGTTTGGAGACTAAGGTAGG + Intronic
905438819 1:37979743-37979765 GCTACTCAGGAGTCTAAGGTGGG + Intronic
906420231 1:45659827-45659849 GCTACTCTGGAGGCTAAGGTGGG + Intronic
907114827 1:51959398-51959420 TCCACTCTGGAGGCTGTGGTGGG + Intronic
907374827 1:54027952-54027974 TCTACACTAGAGTCTAGGGTGGG - Intergenic
907398604 1:54210008-54210030 TCCTCTCTGGAGGCGATGGTGGG - Exonic
907603939 1:55796918-55796940 GCTACTCAGGAGTCTAAGGTAGG + Intergenic
908197239 1:61757181-61757203 TCTACTCAGGAGGCTAAGGTGGG - Intronic
908613339 1:65887527-65887549 GCTACTCTGGAGGCTAAGGTGGG - Intronic
908681558 1:66667410-66667432 GATTCTCTGGAGTGTATGTTTGG + Intronic
908798526 1:67855028-67855050 TCTACTCTGGAGGCTGAGGTGGG + Intergenic
909676234 1:78241883-78241905 GCTACTCTGGAGGCTAAGGTGGG - Intergenic
910529466 1:88219059-88219081 TCTTTTCTGAAGGCTCTGGTAGG - Intergenic
910834475 1:91494416-91494438 TCTTCTTTGGAGTCAACAGTGGG - Intergenic
911548759 1:99254140-99254162 TCTGCTCAGGAGGCTAAGGTGGG + Intergenic
911640435 1:100282916-100282938 GCTACTCGGGAGTCTGTGGTGGG - Intronic
912412242 1:109487348-109487370 TCTTCCCTGGAATATATGGAAGG - Intronic
912916682 1:113822600-113822622 TCTTCTCTGGACCCTTTGGCTGG + Intronic
912943144 1:114062442-114062464 GCTACTCTGGAGTCTAAGGTGGG - Intergenic
913049297 1:115102786-115102808 TCCTCCCTGGACTCTATGTTTGG + Intergenic
913640732 1:120809947-120809969 CCCTCTCTGGCATCTATGGTGGG + Intronic
914218664 1:145657277-145657299 GCTACTCAGGAGGCTATGGTGGG + Intronic
914364296 1:146964493-146964515 CCCTCTCTGGCATCTATGGTGGG + Intronic
914471221 1:147979972-147979994 GCTACTCAGGAGGCTATGGTGGG + Intronic
914587728 1:149077797-149077819 CCCTCTCTGGCATCTATGGTGGG - Intronic
914796221 1:150922814-150922836 TCATCTCTGGAAGGTATGGTGGG - Intergenic
915069827 1:153257543-153257565 TCTACTCTGGAGGCTGAGGTGGG - Intergenic
915139224 1:153756420-153756442 GCTTCTCAGGAGGCTGTGGTGGG + Intronic
915478780 1:156170807-156170829 GCTTCTCAGGAGGCTAAGGTAGG + Intronic
917150407 1:171937679-171937701 GCTACTCTGGAGTCTGAGGTAGG - Intronic
917923361 1:179769255-179769277 GCTACTCAGGAGGCTATGGTAGG - Intronic
917992318 1:180394203-180394225 ACTACTCTGGAGGCTGTGGTGGG - Intronic
918344487 1:183594294-183594316 GCTTCTCAGGAGGCTAAGGTGGG + Intronic
919538544 1:198819619-198819641 TCTCCCCTGGAGTCTCTGGAAGG - Intergenic
920492029 1:206423884-206423906 GCTACTCAGGAGGCTATGGTGGG - Intronic
920958186 1:210638791-210638813 GCTTCTCTGGAGGCTGAGGTGGG + Intronic
921161746 1:212477670-212477692 GCTACTCTGGAGGCTAAGGTGGG - Intergenic
921521281 1:216157169-216157191 TCTTCTGTGAAGTGTATGTTTGG - Intronic
922540756 1:226417504-226417526 ACTACTCTGGAGGCTAAGGTGGG - Intergenic
922590993 1:226776614-226776636 GCTTCTCTGGAGGCTAAGGCAGG - Intergenic
922713633 1:227853149-227853171 GCTACTCTGGAGGCTGTGGTGGG - Intergenic
923090487 1:230736833-230736855 GCTTCCCTGGAGTCTGTGGGAGG + Intergenic
923715797 1:236423992-236424014 GCTTCTTGGGAGTCTAGGGTAGG + Intronic
924191381 1:241556379-241556401 GCTACTCTGGAGTCTGAGGTGGG - Intronic
924422092 1:243918910-243918932 TCGTCTCCAGAGCCTATGGTTGG + Intergenic
1062839829 10:661611-661633 TCTTCTCTGGACTCTAAGCAGGG + Intronic
1064110718 10:12536388-12536410 GCTACTCTGGAGGCTAAGGTAGG - Intronic
1064113601 10:12559192-12559214 TCTACTCTGGAGGCTGAGGTGGG + Intronic
1064259796 10:13776220-13776242 GCTTCTCTGGAGGCTGAGGTGGG - Intronic
1065336789 10:24660437-24660459 TCTTTTCTGAAGTCTTTGGGAGG - Intronic
1065923538 10:30415241-30415263 GCTACTCTGGAGGCTATGGCAGG - Intergenic
1066261798 10:33736548-33736570 TCTACTCTGGAGGCTGAGGTGGG - Intergenic
1066568928 10:36750334-36750356 GCTACTCTGGAGGCTAAGGTGGG + Intergenic
1066758332 10:38731765-38731787 GCTACTCTGGAGGCTGTGGTGGG + Intergenic
1068043386 10:51855977-51855999 TCTTCCCTGGAGTCTCTGGAAGG - Intronic
1069752835 10:70755193-70755215 GCTGCTCTGGAGGCTAGGGTAGG + Intronic
1070250971 10:74772630-74772652 TCTTCTCAGAAGGCTGTGGTGGG - Intergenic
1070502917 10:77088539-77088561 GCTACTCTGGAGGCTGTGGTGGG - Intronic
1070529533 10:77324645-77324667 GCTACTCTGGAGGCTAAGGTTGG - Intronic
1070621772 10:78018062-78018084 TCTACTTTGGAGCCTAAGGTGGG + Intronic
1071726019 10:88199011-88199033 TTTGCTCTGGAGTCTTTGCTGGG - Intergenic
1072495870 10:95958378-95958400 GCTACTCTGGAGGCTAAGGTGGG + Intronic
1072540931 10:96397533-96397555 TCTTCTCTGGATACTTTGATGGG - Intronic
1073116025 10:101092394-101092416 TCTACTCGGGAGGCTAAGGTGGG - Intronic
1073154143 10:101333311-101333333 TATTTGCTGGGGTCTATGGTTGG + Intergenic
1073172344 10:101521160-101521182 GCTACTCTGGAGGCTAAGGTGGG + Intronic
1073739648 10:106392340-106392362 GCTACTCTGGAGGCTCTGGTGGG + Intergenic
1074806373 10:117057187-117057209 TCAACTCTGGAGTCTATTGAAGG + Intronic
1075526548 10:123191762-123191784 TCTTCTCTAGAGGCTCTGGAAGG + Intergenic
1076396466 10:130141847-130141869 TCATTGCTGGAGGCTATGGTGGG + Intronic
1076964039 11:64369-64391 TTTTCTTTGGAGTATATTGTTGG + Intergenic
1077667027 11:4120905-4120927 GCTTCTCTGGAGGCTGAGGTGGG + Intronic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1078132979 11:8628499-8628521 GATTCTCTGGAGGCTAAGGTGGG + Intronic
1078184330 11:9038995-9039017 GCTACTCAGGAGTCTAAGGTGGG - Intronic
1078233576 11:9464241-9464263 GCTACTCTGGAGTCTGAGGTGGG - Intronic
1079381890 11:19945484-19945506 GCTACTCTGGAGGCTAAGGTTGG - Intronic
1079383317 11:19957932-19957954 TCTTCTCAGGAAACTAGGGTTGG + Intronic
1080080534 11:28213407-28213429 ACTTATCTTGTGTCTATGGTTGG - Intronic
1081866342 11:46362484-46362506 CATGCTCTGGTGTCTATGGTGGG + Intronic
1082084862 11:48041734-48041756 TCTACTCAGGAGGCTAAGGTGGG - Intronic
1083754746 11:64785699-64785721 GCTACTCTGGAGGCTAAGGTGGG - Intergenic
1083770050 11:64862018-64862040 GCTACTCAGGAGTCTAAGGTGGG - Intronic
1083787689 11:64961898-64961920 GCTACTCTGGAGGCTAAGGTGGG - Intronic
1084127257 11:67107816-67107838 GCTACTCTGGAGGCTATGGCAGG + Intergenic
1084921705 11:72476069-72476091 GCTACTCTGGAGGCTAAGGTGGG - Intergenic
1086623866 11:88921516-88921538 GCTACTCTGGAGGCTATGGCAGG + Intronic
1086798244 11:91136332-91136354 ACTACTCTGGAGGCTGTGGTGGG + Intergenic
1087037246 11:93767849-93767871 GCTACTCTGGAGGCTAAGGTGGG - Intronic
1087941221 11:104099518-104099540 GCTACTCTGGAGGCTAAGGTGGG + Intronic
1088650280 11:111951975-111951997 TCTTCTCAGGAGGCTGAGGTAGG - Intronic
1088661819 11:112054794-112054816 TCTTCTCTATAGTCTTTGGAGGG - Intronic
1089147947 11:116344049-116344071 TCTTTCCTGGAGTCTCTGGAAGG - Intergenic
1089236795 11:117035664-117035686 GCTACTCTGGAGGCTAAGGTGGG - Intronic
1089649654 11:119904456-119904478 ACTTCTCTGCAGTCTATACTGGG + Intergenic
1090017430 11:123098645-123098667 GCTTCTCTGGAGCCTGAGGTGGG - Intronic
1090336174 11:125967746-125967768 GCTGCTCTGGAGGCTAAGGTGGG - Intronic
1090373388 11:126272402-126272424 GCTACTCTGGAGGCTAAGGTGGG - Intronic
1090529315 11:127574300-127574322 TCTTCTTTGGTGTCTGGGGTAGG + Intergenic
1091490719 12:930265-930287 TCTTCTCGGGAGGCTGAGGTGGG + Intronic
1094588195 12:31797128-31797150 GCTACTCTGGAGGCTAAGGTAGG - Intergenic
1094704104 12:32897589-32897611 TCTTCTCTAGAGCCTCTTGTTGG - Intergenic
1095584314 12:43833979-43834001 TCTACTCTGGAGGCTGAGGTGGG + Intergenic
1096052503 12:48623630-48623652 GCTACTCTGGAGCCTGTGGTGGG - Intergenic
1096295814 12:50383136-50383158 GCTACTCTGGAGGCTAAGGTGGG + Intronic
1096642156 12:53003281-53003303 GCTTCTCGGGAGGCTAAGGTAGG + Intergenic
1097764388 12:63508411-63508433 GCTACTCTGGAGTCTGAGGTGGG + Intergenic
1098076075 12:66733098-66733120 GCTTCTCAGGAGGCTAAGGTGGG - Intronic
1099592478 12:84612399-84612421 GCTACTCTGGAGGCTAAGGTAGG + Intergenic
1099975521 12:89542143-89542165 TTTTCTCTAGTGTCTATGGAGGG - Intergenic
1101224042 12:102669726-102669748 TCTTCTCAGAAGTCTCTGGGAGG + Intergenic
1101568644 12:105933384-105933406 GCTACTCTGGAGGCTAAGGTGGG - Intergenic
1102093083 12:110210625-110210647 GCTACTCTGGAGGCTAAGGTGGG + Intronic
1102234044 12:111283104-111283126 TCTACTCTGGAGGCTGAGGTGGG + Intronic
1102256827 12:111420254-111420276 GCTACTCTGGAGGCTATGGTGGG + Intronic
1102963354 12:117108003-117108025 TCTCCTCTGGAGCCTCTGGAAGG + Intergenic
1103677255 12:122665705-122665727 GCTTCTCAGGAGGCTAAGGTGGG - Intergenic
1104031519 12:125068345-125068367 GCTACTCTGGAGACTAAGGTGGG + Intronic
1104141887 12:125995371-125995393 TATGCTCAGGAGTCTAGGGTGGG - Intergenic
1104351064 12:128044410-128044432 TCTTACCTGGAGGCTCTGGTAGG - Intergenic
1104394822 12:128423621-128423643 GCTACTCTGGAGGCTAAGGTGGG + Intronic
1104484615 12:129139820-129139842 GCTACTCAGGAGTCTGTGGTGGG - Intronic
1104567236 12:129896079-129896101 GCTACTCTGGAGGCTAAGGTGGG - Intronic
1104828642 12:131733110-131733132 TTGTCTCTGGTGTCCATGGTTGG - Intronic
1105964765 13:25373761-25373783 TCTCCTCTTGGATCTATGGTAGG - Intronic
1106209185 13:27625173-27625195 TGTCCTCTGGAGTCCATGGGAGG + Intronic
1106316324 13:28597174-28597196 GCTACTCAGGAGGCTATGGTGGG - Intergenic
1106383430 13:29262479-29262501 GCTTCTCTGGAGTGTCTGGGTGG + Intronic
1106451992 13:29890585-29890607 GCTACTCTGGAGTCTGAGGTGGG - Intergenic
1107906460 13:45065691-45065713 TCTACTCTGGAGGCTGAGGTGGG - Intergenic
1108970323 13:56367132-56367154 GCTTCTCTGGAGGCTGTGGCAGG + Intergenic
1109530753 13:63643371-63643393 GCTTTTCAGGAGGCTATGGTGGG - Intergenic
1110635890 13:77766627-77766649 TCTACTCTGGAGGCTAAGGCAGG - Intergenic
1110756507 13:79181041-79181063 GCTACTCTGGAGGCTAAGGTGGG - Intergenic
1110825640 13:79968527-79968549 GCTACTCAGGAGGCTATGGTGGG - Intergenic
1111799796 13:92967635-92967657 TCTTGTTTGGAGTCTGAGGTAGG - Intergenic
1112708981 13:102104672-102104694 GCTACTCTGGAGGCTAAGGTAGG + Intronic
1114546529 14:23506692-23506714 TCTGCTGTTGATTCTATGGTGGG + Intronic
1114798524 14:25743895-25743917 GCTTCTCTGGAGACTGAGGTGGG - Intergenic
1115125344 14:29986000-29986022 TCTACTCTGGAGGCTAAGGCAGG + Intronic
1115677931 14:35701752-35701774 GCTACTCTGGAGCCTAAGGTGGG - Intronic
1117405876 14:55403006-55403028 ACTTCTCTGGAGGCTCAGGTAGG + Intronic
1117590743 14:57265611-57265633 GCTACTCTGGAGGCTAAGGTGGG + Intronic
1117867310 14:60163398-60163420 ACTACTCTGGAGGCTAAGGTAGG - Intronic
1118205010 14:63714837-63714859 GCTACTCTGGAGGCTAAGGTGGG - Intronic
1118230726 14:63946314-63946336 GCTTCTCTGGAGACTGAGGTGGG + Intronic
1118986426 14:70759562-70759584 TCTTCACTAGAGTCTCTGGAGGG + Intronic
1119214498 14:72858194-72858216 TCTACTCAGGAGGCTAAGGTGGG + Intronic
1119225963 14:72944678-72944700 GCTACTCGGGAGGCTATGGTGGG + Intronic
1119707783 14:76796650-76796672 TCTTCTCTGCTGTCAATGTTCGG + Intronic
1121136808 14:91506660-91506682 TCTGCTCTGGAGGCTGAGGTGGG - Intronic
1123936653 15:25197272-25197294 TCATCTCATGAGTCCATGGTGGG + Intergenic
1125345151 15:38711857-38711879 TCTTCTCTGGGCTCTATATTGGG - Intergenic
1125650997 15:41317788-41317810 GCTACTCTGGAGGCTAAGGTGGG - Intronic
1125700347 15:41677251-41677273 GCTACTCTGGAGGCTAGGGTGGG - Intronic
1126258034 15:46651032-46651054 TCTTCTTTGAAGTCTATTTTTGG - Intergenic
1126326952 15:47489243-47489265 TCCTCTCTGGAGTCTTTGGAGGG + Intronic
1126923536 15:53555314-53555336 TCTGCTCTGAAGTCTTTCGTGGG - Intronic
1127503937 15:59580273-59580295 GCTACTCTGGAGGCTGTGGTTGG - Intergenic
1127572668 15:60259657-60259679 TCTTCTTTAGTGTCTGTGGTAGG - Intergenic
1127676206 15:61241780-61241802 TCTTCTCTGGAGGCAGTGTTGGG - Intergenic
1128061291 15:64737367-64737389 ACTACTCTGGAGGCTAAGGTGGG + Intergenic
1128131332 15:65229019-65229041 GCTACTCTGGAGGCTAAGGTGGG - Intergenic
1129429749 15:75490995-75491017 GCTGCTCAGGAGTCTAAGGTGGG + Intronic
1129807473 15:78475738-78475760 GCTACTCTGGAGGCTAAGGTGGG + Intronic
1129886250 15:79039879-79039901 GCTTCTCAGGAGGCTAAGGTGGG - Intronic
1130006471 15:80103958-80103980 GCTACTCAGGAGCCTATGGTGGG - Intronic
1131585729 15:93690759-93690781 TCTTCTCTTGGGCCTCTGGTAGG + Intergenic
1132203032 15:99968220-99968242 TCTTCTCTTGAGCCTCTGGGTGG + Intergenic
1132301822 15:100780758-100780780 TCTTCTGTGGAGGGGATGGTTGG - Intergenic
1132444512 15:101900811-101900833 TTTTCTTTGGAGTATATTGTTGG - Intergenic
1133039153 16:3050722-3050744 GCTACTCTGGAGTCTGAGGTGGG - Intronic
1133391223 16:5411769-5411791 TCTACTCTGGAGGCTGAGGTGGG + Intergenic
1133826799 16:9285150-9285172 GCTACTCTGGAGGCTAGGGTGGG - Intergenic
1133924985 16:10184784-10184806 TCCTTTCTTGAGTCTATGGCTGG + Intergenic
1134117878 16:11562783-11562805 GCTGCTCTGGAGGCTAAGGTAGG + Intronic
1134659456 16:15972908-15972930 GCTACTCTGGAGGCTAAGGTGGG - Intronic
1134755013 16:16659430-16659452 ACTACTCTGGAGGCTGTGGTGGG - Intergenic
1134991050 16:18699743-18699765 ACTACTCTGGAGGCTGTGGTGGG + Intergenic
1135138153 16:19899799-19899821 TCTACTCTGGAGGCTGAGGTAGG - Intergenic
1135673072 16:24391337-24391359 ACTTCTCAGGAGGCTAAGGTGGG + Intergenic
1135987200 16:27192719-27192741 GCTACTCTGGAGGCTATGGCAGG + Intergenic
1136125469 16:28176607-28176629 GCTACTCTGGAGGCTGTGGTAGG - Intronic
1136465588 16:30441348-30441370 GCTTCTCTGGAGGCTGGGGTGGG - Intergenic
1136790111 16:32962611-32962633 GCTACTCAGGAGTCTAAGGTGGG + Intergenic
1136879702 16:33891317-33891339 GCTACTCAGGAGTCTAAGGTGGG - Intergenic
1137609264 16:49808171-49808193 GCTACTCAGGAGGCTATGGTGGG - Intronic
1137851372 16:51748536-51748558 TCTTCCATGGTGTCCATGGTAGG + Intergenic
1138554649 16:57764437-57764459 TCTTCCCTGCAGTCTTTGGGCGG - Intronic
1139246318 16:65447967-65447989 GCTCCTCTGGACTCTATGCTGGG - Intergenic
1139284145 16:65795862-65795884 TCCTCTCTAGAGTCTCTGGCTGG - Intergenic
1139680260 16:68556056-68556078 GCTACTCTGGAGGCTAAGGTGGG + Intronic
1139730745 16:68943010-68943032 GCTACTCGGGAGTCTAAGGTGGG - Intronic
1140240352 16:73194309-73194331 GCTACTCTGGAGGCTGTGGTGGG - Intergenic
1140402372 16:74682141-74682163 GCTTCTCAGGAGGCTAAGGTAGG + Intronic
1140843969 16:78869189-78869211 TGTTCTGTGGACTCTGTGGTGGG + Intronic
1141226206 16:82118407-82118429 GCTCCTCTGGAGGCTAAGGTGGG + Intergenic
1143234469 17:5387250-5387272 TCTCCTCTGAAGTATATGTTGGG - Intronic
1143905123 17:10202235-10202257 GCTTCTCTGGAGGCTGAGGTGGG - Intergenic
1144275859 17:13667596-13667618 TGTTTGCAGGAGTCTATGGTGGG - Intergenic
1144799782 17:17917841-17917863 TCTACTCAGGAGGCTAAGGTGGG + Intronic
1145047825 17:19632422-19632444 GCTACTCAGGAGTCTATGGCAGG - Intergenic
1145117983 17:20229560-20229582 GCTTCTCTGGAGGCTGAGGTGGG + Intronic
1146029382 17:29351859-29351881 GCTACTCTGGAGGCTAAGGTGGG - Intergenic
1146045494 17:29502316-29502338 GCTTCTCAGGAGTCTGAGGTAGG + Intronic
1146128050 17:30244557-30244579 GCTACTCTGGAGGCTAAGGTGGG + Intergenic
1146134694 17:30308992-30309014 TCTACTCTGGAGGCTGAGGTGGG - Intergenic
1146144228 17:30397624-30397646 TCTACTCAGGAGGCTAAGGTGGG + Intronic
1146883947 17:36458508-36458530 GCTACTCTGGAGGCTGTGGTGGG + Intergenic
1147026569 17:37590057-37590079 GCTTCTCTGGAGGCTAAGGCAGG + Intronic
1147154158 17:38535018-38535040 GCTTCTCTGGAGGCTGAGGTGGG + Intronic
1147347711 17:39813530-39813552 GCTACTCTGGAGTCTCGGGTGGG + Intronic
1147683046 17:42266279-42266301 TCTACTCTGGAGGCTGAGGTGGG + Intronic
1149812918 17:59695324-59695346 TCTTCTGTGGAGCTTATGTTAGG - Exonic
1149921722 17:60666723-60666745 GCTACTCTGGAGTCTGAGGTAGG + Intergenic
1150515429 17:65804958-65804980 TCTACTCTGGAGGCTGAGGTGGG - Intronic
1153565970 18:6417638-6417660 GCTTCTCTGGAGGCTGAGGTGGG - Intergenic
1153920126 18:9781637-9781659 TTTCCTCTGGAGTCAATGTTAGG + Intronic
1154126560 18:11697444-11697466 GCTTCTCAGGAGGCTAAGGTGGG + Intronic
1154321313 18:13355741-13355763 GCTACTCTGGAGGCTAAGGTGGG - Intronic
1155196036 18:23475515-23475537 GCTACTCGGGAGTCTAAGGTGGG + Intronic
1155405573 18:25483296-25483318 TCTGCCCTAGAGTCTTTGGTAGG - Intergenic
1155460243 18:26071714-26071736 GCTTCTCAGGAGGCTATGGCAGG + Intronic
1156252504 18:35364630-35364652 TCTTCTCTGGTTTCTATTCTGGG + Intergenic
1156884812 18:42122723-42122745 TATTTTCTGGATTCTATGATTGG + Intergenic
1158581889 18:58691108-58691130 TCTTCTCTGGAGGAGATGGCGGG - Intronic
1159583876 18:70264230-70264252 GCTACTCAGGAGTCTAAGGTGGG - Intergenic
1159597056 18:70392642-70392664 TCTTCCCTGGAGGCTATAGTGGG - Intergenic
1159608794 18:70503509-70503531 TCTTCTCTGTTGTCTCTGTTGGG + Intergenic
1160001882 18:75032510-75032532 TCTTCTCTCGACTCTAAGGTAGG + Intronic
1160462290 18:79048328-79048350 CCTTCTCTGCAGCCTATGGTGGG - Intergenic
1160640842 19:134001-134023 TTTTCTTTGGAGTATATTGTTGG + Intergenic
1161095121 19:2385737-2385759 TCTACTCTGGAATCTAAGGCAGG + Intergenic
1161686284 19:5704241-5704263 TCTCCTCTGGAGCCTCTGGGAGG + Intronic
1161730727 19:5959057-5959079 TCTGCTCTGGAGTCCAGGGGAGG + Intronic
1162960219 19:14121230-14121252 TCTACTCTGGAGGCTGAGGTGGG - Intronic
1163204995 19:15795885-15795907 GCTTCTCTGGAGGCTGAGGTGGG - Intergenic
1163495582 19:17644801-17644823 CCTACTCTGGAGGCTAAGGTGGG - Intronic
1163740857 19:19011023-19011045 GCTACTCTGGAGGCTAAGGTGGG + Intronic
1164189862 19:22904158-22904180 GCAACTCTGGAGTCTATGGGAGG + Intergenic
1164774732 19:30844081-30844103 GCTTCTCGGGAGGCTAAGGTAGG + Intergenic
1164995229 19:32716337-32716359 TCTTCTCAGGAGGCTGAGGTGGG + Intergenic
1165492540 19:36132973-36132995 GCTACTCTGGAGGCTAAGGTGGG + Intergenic
1165779327 19:38423082-38423104 TCTTCTCCCGAGTCCCTGGTAGG - Intronic
1165815437 19:38639164-38639186 GCTACTCTGGAGGCTAAGGTGGG + Intergenic
1166056275 19:40291302-40291324 ACTACTCTGGAGTCTGAGGTGGG - Intergenic
1166167183 19:40999798-40999820 GCTACTCTGGAGGCTAAGGTGGG - Intronic
1166215186 19:41330357-41330379 GCTACTCTGGAGGCTAAGGTGGG - Exonic
1166600196 19:44087061-44087083 TCTGCTGTGGAGTCTTTGATGGG - Exonic
1166604903 19:44132536-44132558 TCTACTGTGGAGTCTCTGATGGG - Exonic
1166869093 19:45860016-45860038 GCTACTCTGGAGGCTAAGGTGGG + Intronic
1167012411 19:46817384-46817406 TCTTCTCTTGAGCCTAGGGATGG - Intergenic
1167141371 19:47653133-47653155 GCTACTCTGGAGTCTGAGGTCGG - Intronic
1167416053 19:49373189-49373211 GCTACTCTGGAGGCTGTGGTGGG + Intronic
1167611342 19:50509187-50509209 GCTACTCTGGAGGCTAAGGTGGG - Intronic
1168006602 19:53494910-53494932 GCTGCTGTGGAGTCTGTGGTAGG + Exonic
1168410047 19:56134141-56134163 TCATCTCTGGAGGCTCGGGTTGG - Intronic
1168484822 19:56752242-56752264 GCTACTCTGGAAGCTATGGTGGG - Intergenic
925131308 2:1495977-1495999 CCTTCTCTGGAGGTTTTGGTGGG + Exonic
926178199 2:10616101-10616123 TCTTCTCTGGAGTAAATGAAAGG + Intronic
926544764 2:14225986-14226008 TCTTTCCTGGAGTCTCTGGCCGG - Intergenic
927691611 2:25212428-25212450 TCTTCTCTGGAGTTGATAGAAGG + Intergenic
927945143 2:27131122-27131144 TCAACTCTGGAGCCTCTGGTAGG + Exonic
928700728 2:33896117-33896139 TCTCCTCTGGAGTCTACAGAAGG + Intergenic
928892612 2:36221620-36221642 TCTTCCCTGGAGGCTTTGGAGGG - Intergenic
929229449 2:39544297-39544319 GCTACTCTGGAGTCTAAGGCAGG + Intergenic
929464457 2:42132319-42132341 CCTTCTCTGGAAGCAATGGTAGG - Intergenic
929903606 2:46027055-46027077 GCTACTCTGGAGGCTAAGGTGGG + Intronic
931230772 2:60372583-60372605 GCATCTCTGGACCCTATGGTAGG - Intergenic
931288636 2:60853561-60853583 TGTACTGTGGAGGCTATGGTGGG - Intergenic
931400819 2:61929810-61929832 GCTTTTCTGGAGGCTAAGGTGGG + Intronic
931460541 2:62446788-62446810 TTTTCTCTGGAGGGTAAGGTGGG + Intergenic
931660109 2:64552660-64552682 TCTTCTGTGGGGTCAATGTTTGG - Exonic
932092322 2:68817486-68817508 TCCTCTCTGGAGACTTGGGTGGG + Intronic
932645979 2:73502826-73502848 TCTTCTTTGGAGTATTTTGTGGG + Intronic
932767774 2:74482184-74482206 TTTTCTCTGTAGTGTGTGGTAGG + Exonic
932964545 2:76456061-76456083 GCTTCTCAGGATTCTATGGATGG - Intergenic
933182952 2:79247890-79247912 TCTTCTCTGGAGCCTCTAGAAGG + Intronic
933210294 2:79559332-79559354 TATTCTTTGGAGTTTATGATTGG + Intronic
933919045 2:87026278-87026300 GCTACTCTGGAGTCTGAGGTGGG - Intergenic
933941399 2:87248036-87248058 GCTACTCGGGAGGCTATGGTGGG - Intergenic
934003949 2:87743632-87743654 GCTACTCTGGAGTCTGAGGTGGG + Intergenic
935948383 2:108306490-108306512 GCTTCTCAGGAGGCTAAGGTGGG + Intronic
936338825 2:111613555-111613577 GCTACTCGGGAGGCTATGGTGGG + Intergenic
936521952 2:113217098-113217120 CCTTGTGGGGAGTCTATGGTTGG + Exonic
936580141 2:113693260-113693282 GCTACTCTGGAGGCTAAGGTAGG - Intergenic
937107795 2:119334576-119334598 GCTACTCAGGAGGCTATGGTGGG + Intronic
938042434 2:128086692-128086714 GCTACTCTGGAGGCTAAGGTAGG - Intergenic
938917482 2:135957174-135957196 TCTACTCTGGAGGCTGAGGTGGG - Intronic
939081214 2:137663961-137663983 GCTACTCTGGAGGCTATGGCAGG - Intronic
939088130 2:137746203-137746225 TCTTCTCTGGGTTCTCTGTTTGG - Intergenic
940653052 2:156456489-156456511 GCTTCTCTGGAGGCTGAGGTGGG + Intronic
941077376 2:161020959-161020981 GCTACTCTGGAGGCTAAGGTGGG + Intergenic
941252157 2:163179240-163179262 GCTACTCTGGAGGCTAGGGTAGG - Intergenic
941266795 2:163372511-163372533 AGTTCTCTGGAGGCTATTGTTGG - Intergenic
941794187 2:169581988-169582010 GCTACTCTGGAGACTAAGGTGGG + Intergenic
942902254 2:181135253-181135275 GCTACTCTGGAGGCTGTGGTAGG - Intergenic
943581567 2:189689776-189689798 TCTTTGCTGTAGTCTCTGGTAGG - Exonic
944746763 2:202664997-202665019 TTTTATCTGGAGACTTTGGTGGG + Intronic
945199630 2:207268032-207268054 GCTACTCTGGAGGCTAAGGTAGG + Intergenic
945425619 2:209696709-209696731 TCATCTCTGGAGACTGTGCTAGG - Exonic
945805373 2:214483966-214483988 TCTTCTCTAGAGTTTCTGGAGGG - Intronic
946243975 2:218375000-218375022 GCTACTCTGGAGGCTGTGGTGGG - Intergenic
946356640 2:219190210-219190232 GCTTCTCAGGAGGCTGTGGTGGG - Intergenic
947214211 2:227735416-227735438 TCTACTCAGGAGGCTAAGGTGGG + Intergenic
947945420 2:234097771-234097793 TCTACTCTGGAGGCTGAGGTGGG - Intergenic
948386321 2:237583224-237583246 GCTACTCTGGAGGCTAAGGTGGG + Intronic
948552697 2:238785088-238785110 TCTTCCCTGGAGTCTCTTGCAGG - Intergenic
948656329 2:239478834-239478856 GCTACTCTGGAGGCTAAGGTGGG + Intergenic
948781968 2:240327383-240327405 TCTTCTCTCGAGCCTTTGGAGGG - Intergenic
1169423604 20:5479142-5479164 GCTTCTCTGGATACTAAGGTGGG - Intergenic
1169427387 20:5507225-5507247 GCTACTCTGGAGACTAAGGTGGG + Intergenic
1169453143 20:5729263-5729285 TCTTCTCTGGAGTCTCCAGAAGG + Intergenic
1170825418 20:19790543-19790565 TCTACTCTGGAGGCTGAGGTAGG + Intergenic
1172296453 20:33814546-33814568 TCGCCTCTGGAGTCTGTGGGTGG + Intronic
1173425038 20:42935249-42935271 GCTTCTCAGGAGGCTAAGGTAGG - Intronic
1174098769 20:48110532-48110554 TCTACTCTGGAGGCTGAGGTGGG - Intergenic
1174333776 20:49842847-49842869 TCTTTTCTAGAGTCTTTGGGAGG - Intronic
1174843150 20:53918696-53918718 GCTACTCTGGAGTCTGAGGTGGG + Intergenic
1175944915 20:62554183-62554205 TCTTCCCTGGAGTCTACTGCCGG - Intronic
1176520557 21:7821121-7821143 TCTACTCTGGAGGGTAGGGTAGG - Intronic
1177131747 21:17265855-17265877 TCTTCTCTCTAGTCTTTGTTAGG - Intergenic
1177379686 21:20323514-20323536 TTTTCTCTGGAGTCTTTGGGGGG + Intergenic
1177403961 21:20642204-20642226 GCTTCTCCGGAGGCTAAGGTGGG + Intergenic
1177944864 21:27455672-27455694 TCTTGTCTGTAGTGTATGCTGGG + Intergenic
1178078615 21:29037695-29037717 GCTACTCTGGAGGCTAAGGTAGG - Intronic
1178654579 21:34451133-34451155 TCTACTCTGGAGGGTAGGGTAGG - Intergenic
1178785457 21:35649285-35649307 TCTTCTCTGCAGTCAGTGTTTGG - Intronic
1178878378 21:36429751-36429773 GCTTCTCAGGAGGCTAAGGTGGG + Intergenic
1181080262 22:20409569-20409591 GCTACTCTGGAGGCTATGGTGGG + Intergenic
1182172010 22:28240572-28240594 TCCTCTCTGGAGACTAAGCTAGG - Intronic
1182330946 22:29551637-29551659 GCTACTCTGGAGGCTAGGGTGGG + Intronic
1183661801 22:39225629-39225651 TCTTCTCTGTGGTCTGTGGATGG - Intronic
1183995418 22:41629779-41629801 GCTACTCTGGAGGCTAAGGTAGG - Intronic
1184178558 22:42804013-42804035 GCTACTCTGGAGGCTAAGGTGGG - Intronic
1184638286 22:45853675-45853697 GCTACTCCGGAGGCTATGGTGGG + Intergenic
1184665378 22:45986285-45986307 TCTTATCTGGAGGCTTTGGAAGG - Intergenic
949548338 3:5091681-5091703 GCTACTCTGGAGGCTAAGGTGGG + Intergenic
950396924 3:12740744-12740766 GCTTCTCAGGAGGCTAAGGTAGG + Intronic
951664270 3:25104530-25104552 GCTACTCGGGAGGCTATGGTAGG + Intergenic
953887328 3:46722641-46722663 GCTACTCTGGAGGCTAAGGTGGG + Intronic
953924558 3:46975955-46975977 GCTTCTCGGGAGGCTATGGCAGG - Intronic
955004862 3:54958987-54959009 GCTACTCGGGAGACTATGGTGGG + Intronic
955302864 3:57799923-57799945 TCTACTCTGGAGGCTATGGCAGG + Intronic
955933640 3:64081644-64081666 TCTACTCTGGAGGCTGAGGTGGG + Intergenic
956056382 3:65302998-65303020 TCTTCTCAGGAGGCTGAGGTGGG + Intergenic
956584130 3:70846158-70846180 GCTACTCTGGAGGCTAAGGTGGG - Intergenic
956840637 3:73136641-73136663 GCTACTCAGGAGTCTAAGGTGGG + Intergenic
956933086 3:74068314-74068336 GCTACTCTGGAGGCTAAGGTGGG + Intergenic
957351965 3:79035611-79035633 GCTACTCTGGAGGCTAAGGTGGG + Intronic
958616486 3:96499593-96499615 GCTACTCAGGAGTCTAAGGTGGG + Intergenic
959270346 3:104200184-104200206 TCTTCTCTGGAGTCTCCAGATGG + Intergenic
960795346 3:121480565-121480587 GCTACTCAGGAGTCTAAGGTGGG - Intronic
962669771 3:137693178-137693200 TCTTGGCTGGAGTATATTGTTGG + Intergenic
963689196 3:148477431-148477453 TTTTACTTGGAGTCTATGGTAGG - Intergenic
963806438 3:149727619-149727641 GCTTCTCGGGAGGCTGTGGTGGG + Intronic
964494981 3:157278934-157278956 GCTACTCTGGAGTCTGAGGTGGG + Intronic
964743410 3:159989669-159989691 TCTACTCGGGAGTCTAAGGCAGG + Intronic
965167258 3:165210959-165210981 GCTACTCTGGAGGCTAAGGTGGG - Intergenic
965715663 3:171599718-171599740 TCTACTCAGGAGGCTAAGGTGGG + Intergenic
965843246 3:172931350-172931372 ACTTCTCTGGAGTCTGAGGCAGG - Intronic
966230690 3:177648435-177648457 TTTTCTCTGCAGTCTATAGAGGG - Intergenic
967307984 3:188077357-188077379 CCTTCTCTGGGGTCAGTGGTTGG - Intergenic
967946728 3:194809976-194809998 TCTTTTATGGAGTTTATGGGAGG + Intergenic
968113808 3:196073345-196073367 GCTACTCAGGAGGCTATGGTAGG + Intronic
968859324 4:3153810-3153832 TCTACTCTGGAGGCTGAGGTGGG + Intronic
970173102 4:13308670-13308692 TCTTCACTGCAGTCTTTGGCAGG + Intergenic
970282734 4:14475973-14475995 GCTACTCTGGAGGCTAAGGTGGG - Intergenic
970602857 4:17654036-17654058 TCTCCTCTGGAGTCTTTAGAAGG + Intronic
971284607 4:25275546-25275568 GCTACTCTGGAGTCTGGGGTGGG + Intronic
971947635 4:33301696-33301718 GCTCCTCTGGAGGCTGTGGTGGG - Intergenic
972287122 4:37659820-37659842 CCTTGTCTGTAGTCTGTGGTTGG - Intronic
973865182 4:55105801-55105823 TCTTCTCTGGAGGTTTGGGTTGG - Intronic
974060873 4:57033937-57033959 GCTACTCTGGAGGCTAAGGTGGG + Intronic
974090512 4:57305853-57305875 TCTGCTCAGGAGGCTGTGGTGGG - Intergenic
974364570 4:60929378-60929400 GCTACTCTGGAGGCTATGGTGGG + Intergenic
974788333 4:66651664-66651686 TCTTCTCTAAAGTCTCTGGAGGG - Intergenic
975302458 4:72806756-72806778 GCTACTCAGGAGTCTGTGGTGGG + Intergenic
976172794 4:82321693-82321715 GCTACTCAGGAGTCTAAGGTGGG - Intergenic
979262870 4:118668265-118668287 TCTACTTGGGAGTCTAAGGTGGG - Intergenic
979695899 4:123612629-123612651 TGTTCTTTGGAGTATGTGGTAGG - Intergenic
980656998 4:135801846-135801868 GCTACTCTGGAGGCTAAGGTGGG + Intergenic
982861961 4:160463610-160463632 TCTTTTCTGTTGTCTATGGATGG + Intergenic
983651319 4:170039674-170039696 GCTACTCTGGAGGCTAAGGTGGG + Intergenic
983749270 4:171244518-171244540 TATTCTCTGGAATATATGGAAGG + Intergenic
984015355 4:174419424-174419446 GCTACTCTGGAGTCTGAGGTGGG - Intergenic
984634079 4:182092227-182092249 GCTTCTCAGGAGGCTGTGGTGGG + Intergenic
986024593 5:3838730-3838752 TCCTCTCTGGAGCCTCTGCTGGG + Intergenic
987006945 5:13720492-13720514 TCTACTTTGGAGTCTGAGGTGGG - Intronic
987677659 5:21095745-21095767 GCTACTCTGGAGGCTAAGGTAGG - Intergenic
987974195 5:24991337-24991359 GCTACTCTGGAGGCTAAGGTAGG - Intergenic
988448330 5:31312577-31312599 GCTACTCTGGAGGCTAAGGTGGG + Intronic
988574274 5:32404926-32404948 GCTACTCAGGAGTCTAAGGTGGG - Intronic
988691478 5:33576847-33576869 CCTTCTTTGGAGGCTGTGGTAGG + Exonic
989048748 5:37297488-37297510 GCTACTCGGGAGGCTATGGTGGG - Intronic
989049053 5:37300766-37300788 TCTACTCAGGAGTCTGAGGTGGG - Intronic
989602065 5:43209728-43209750 GCTACTCTGGAGGCTTTGGTGGG - Intronic
992367107 5:76104028-76104050 TATTCTATGTAGTCTATGGAAGG + Intronic
992518526 5:77522526-77522548 TCTACTCAGGAGGCTAAGGTGGG + Intronic
992834032 5:80622548-80622570 TCTTCTCTTGATTTTAAGGTGGG - Intergenic
993002673 5:82397407-82397429 TCTTCTTTGGTCTCTCTGGTTGG + Intergenic
993558208 5:89368089-89368111 TCTTCTCTGGAGCCTCTGGAGGG - Intergenic
994213907 5:97115838-97115860 TCTTCTCTGGGGTCAAGGGCAGG + Intronic
995070876 5:107920314-107920336 GCTACTCAGGAGTCTGTGGTAGG - Intronic
995299036 5:110556497-110556519 ACTACTCAGGAGGCTATGGTGGG - Intronic
996436824 5:123443284-123443306 GCTACTCTGGAGTCTGAGGTGGG - Intergenic
997053657 5:130413636-130413658 TCTCCTCTAGAGCCTATGGAGGG - Intergenic
997714178 5:136029602-136029624 TCTTGTCTGGAGTCGCTGGCCGG - Intronic
997994120 5:138572066-138572088 GCTACTCTGGAGGCTAAGGTGGG - Intronic
998961594 5:147493459-147493481 TCTACTCAGGAGGCTGTGGTGGG + Intronic
999005572 5:147973702-147973724 TCTTTTCTGGAGCCTCTGGGGGG + Intergenic
1000360465 5:160442167-160442189 TGTACTCTGGAATCTATGGATGG - Intergenic
1001053842 5:168433647-168433669 GCTACTCTGGAGTCTAAGGCAGG - Intronic
1001064234 5:168523224-168523246 GCTACTCTGGAGGCTAAGGTGGG + Intergenic
1001174427 5:169452958-169452980 TCTACTCTGGAGGCTGAGGTGGG + Intergenic
1001505928 5:172280396-172280418 GCTACTCTGGAGGCTAAGGTAGG + Intronic
1001665701 5:173432024-173432046 GCTACTCTGGAGACTAAGGTGGG - Intergenic
1002002576 5:176206422-176206444 TCTACTCGGGAGGCTGTGGTGGG - Intergenic
1002224022 5:177705190-177705212 TCTACTCGGGAGGCTGTGGTGGG + Intergenic
1002736508 5:181392420-181392442 TTTTCTTTGGAGTATATTGTTGG - Intergenic
1002748189 6:82404-82426 TTTTCTTTGGAGTATATTGTTGG + Intergenic
1002842128 6:915143-915165 TCATCTCTGGAGGCTGTGATGGG + Intergenic
1002968427 6:1990684-1990706 GCTACTCTGGAGGCTAAGGTGGG - Intronic
1003531102 6:6938126-6938148 TCTACTCTGGAGTCTGAGGCAGG + Intergenic
1003940968 6:11026177-11026199 TCTTCTCTGGAGACTAATTTTGG - Intronic
1004062119 6:12207801-12207823 GCTTCTCTGGAGGCTGAGGTTGG + Intergenic
1004475130 6:15964477-15964499 CCTTATCTGAGGTCTATGGTGGG + Intergenic
1004648966 6:17590106-17590128 GCTACTCTGGAGGCTAAGGTGGG - Intergenic
1005214280 6:23507301-23507323 TCTTCTCTGTCATCTATGATTGG - Intergenic
1005336840 6:24805495-24805517 GCTACTCTGGAGTCTGAGGTGGG - Exonic
1006421184 6:33935188-33935210 CCTTCTATGGAGGCCATGGTGGG - Intergenic
1006463647 6:34178139-34178161 GCTACTCTGGAGGCTAAGGTCGG + Intergenic
1006671569 6:35732517-35732539 TTTTCACTGGAGTTTAGGGTAGG + Intergenic
1006979214 6:38133149-38133171 TCTTCTGTGGAGTCCATGGTTGG + Intronic
1007022757 6:38538717-38538739 GCTACTCTGGAGACTAAGGTAGG - Intronic
1007686553 6:43670489-43670511 GCTACTCTGGAGGCTAAGGTGGG + Intronic
1008904940 6:56666845-56666867 TCTTCTTGGGAGTCTGAGGTGGG - Intronic
1009526026 6:64747490-64747512 GCTACTCTGGAGTCTGAGGTAGG - Intronic
1009774729 6:68191690-68191712 ACTACTCTGGAGGCTTTGGTGGG + Intergenic
1010186662 6:73152108-73152130 TCTTCTCAGGAATGTATGATAGG - Intronic
1010615908 6:78012046-78012068 TCTCCTCTGAAGTCTTTGGAGGG + Intergenic
1012273221 6:97240736-97240758 TCTTCTCAGGAGGCTGTGGCAGG - Intronic
1012772982 6:103463949-103463971 TCTCCACTGGAGCCTCTGGTGGG + Intergenic
1013054491 6:106570222-106570244 TCTTCTCTGGAGTCTATGGTAGG + Exonic
1013408470 6:109863372-109863394 TTTTCTGTTGAGTCTATAGTTGG + Intergenic
1013554518 6:111242365-111242387 GCTTCTCTGGAGGCTGAGGTGGG - Intergenic
1014035918 6:116766256-116766278 GCTACTCTGGAGGCTAAGGTGGG - Intergenic
1014037240 6:116781113-116781135 ACTACTCTGGAGTCTGAGGTGGG - Intergenic
1014510678 6:122317748-122317770 TTTTATCTGGAGGCTATGGGAGG - Intergenic
1014535344 6:122607404-122607426 GCTACTCTGGAGGCTAAGGTGGG + Intronic
1015822668 6:137280654-137280676 GCTACTCTGGAGGCTGTGGTGGG - Intergenic
1015847389 6:137535121-137535143 TCTACTCGGGAGGCTAAGGTGGG - Intergenic
1016417222 6:143845485-143845507 GCTACTCTGGAGGCTAAGGTGGG - Intronic
1016472373 6:144388422-144388444 GCTACTCTGGAGGCTAGGGTGGG - Intronic
1017659850 6:156663334-156663356 ACTTCTCTGGAGGCTGAGGTGGG + Intergenic
1018127738 6:160697787-160697809 GCTACTCTGGAGTCTGAGGTGGG + Intergenic
1019241606 6:170667949-170667971 TTTTCTTTGGAGTATATTGTTGG - Intergenic
1020058151 7:5132801-5132823 GCTTCTCTGGAGGCTGGGGTGGG - Intergenic
1020212617 7:6167475-6167497 CCTGCTCTGGAGTCTCTGGAGGG - Intronic
1021022123 7:15614300-15614322 GCTTCTCAGGAGGCTAGGGTTGG + Intronic
1021516945 7:21499561-21499583 TCTTCTCTAGAGTCCTTGGAGGG + Intronic
1021839563 7:24711701-24711723 GCTGCTCTGGAGGCTAAGGTAGG + Intronic
1022317369 7:29257897-29257919 GCTACTCTGGAGGCTAAGGTGGG - Intronic
1022731740 7:33032863-33032885 GCTACTCTGGAGGCTAAGGTGGG - Intronic
1023447824 7:40250286-40250308 GCTACTCTGGAGGCTAAGGTGGG + Intronic
1023696320 7:42851296-42851318 TCTACTCGGGAGGCTGTGGTGGG + Intergenic
1023915679 7:44587076-44587098 GCTTCTCTGGAGGCTGAGGTGGG + Intergenic
1024115700 7:46191124-46191146 TCTTCTCTTGAGAATTTGGTTGG - Intergenic
1025985200 7:66444705-66444727 TCTACTCTGGAGGCTGAGGTCGG - Intergenic
1026002072 7:66568257-66568279 TCTACTCTGGAGGCTGAGGTTGG - Intergenic
1026830948 7:73609781-73609803 GCTACTCTGGAGGCTAAGGTAGG - Intronic
1027057641 7:75060960-75060982 GCTACTCTGGAGACTGTGGTGGG + Intronic
1027258992 7:76450659-76450681 GCTACTCTGGAGGCTAAGGTGGG - Intergenic
1027310364 7:76948739-76948761 GCTACTCTGGAGGCTAAGGTGGG - Intergenic
1027540903 7:79463970-79463992 TCTTCTCTGGAGACAAATGTAGG + Intergenic
1027833461 7:83210837-83210859 TCTACTCTGGAGGCTGAGGTGGG - Intergenic
1028103193 7:86846579-86846601 TCTTCTCTGGAGGGTAGAGTGGG - Intronic
1028704405 7:93821852-93821874 TCATCACTGGAGTCTTTGGAAGG + Intronic
1028723544 7:94060904-94060926 TCTCCTTTGGGGTCAATGGTGGG - Intergenic
1030608797 7:111666965-111666987 TCTTCTCTGGAGGCTGAGGCAGG - Intergenic
1031128856 7:117807597-117807619 TCTTCTGTGTAGTCTAAGCTTGG + Intronic
1032816323 7:135478588-135478610 GCTACTCTGGAGGCTAAGGTGGG + Intronic
1032831812 7:135634874-135634896 TGTGCTATGGAGTCTATGCTTGG + Intronic
1034252616 7:149704563-149704585 TCTCCTCTGGAGCCTTTGGAGGG - Intergenic
1035145536 7:156811866-156811888 TCTTCCCTGGAGACTTTGGAAGG - Intronic
1035506510 8:140147-140169 TTTTCTTTGGAGTATATTGTTGG + Intergenic
1035706738 8:1681544-1681566 GCTTCTCAGGAGGCTAAGGTGGG + Intronic
1036012436 8:4741943-4741965 GCTTCTCTGGAGGCTAAGATGGG - Intronic
1036203176 8:6786122-6786144 ACTTCTCTGGAGGCTGAGGTGGG + Intergenic
1036217543 8:6893141-6893163 GCTTCTCAGGAGACTAAGGTGGG - Intergenic
1036400764 8:8405740-8405762 GCTACTCTGGAGTCTGAGGTAGG - Intergenic
1036476183 8:9095630-9095652 GCTACTCAGGAGTCTAAGGTGGG - Intronic
1039413719 8:37376307-37376329 TCTTCTCTGAAGTGTGTGCTGGG + Intergenic
1041311218 8:56518884-56518906 TCTGCTCTGGAGCCTGTGGAGGG + Intergenic
1042416440 8:68526067-68526089 GCTTCTCAGGAGGCTAAGGTGGG - Intronic
1042529115 8:69796502-69796524 TCTACTCAGGAGGCTGTGGTGGG + Intronic
1042588468 8:70369995-70370017 GCTCCTCTGGAGGCTAAGGTTGG - Intronic
1043867244 8:85389353-85389375 TCTACTCTGGAGGCGAGGGTGGG + Intronic
1043908460 8:85833454-85833476 TCTACTCTGGAGACTGAGGTGGG - Intergenic
1043970820 8:86526622-86526644 GCTACTCTGGAGTCTGAGGTAGG - Intronic
1044586274 8:93871908-93871930 GCTACTCAGGAGTCTGTGGTGGG + Intronic
1045323775 8:101101627-101101649 TTTTCTCTGGAGGCTCTGGGGGG + Intergenic
1045564799 8:103302844-103302866 TCTACTCTGGAGGCTGAGGTGGG + Intronic
1045996223 8:108365269-108365291 TCTTCTCGGGAGGCTGAGGTAGG - Intronic
1046388226 8:113532003-113532025 TTTTCTCTGGATTCTATCTTTGG - Intergenic
1046542833 8:115608956-115608978 GCTACTCTGGAGGCTAAGGTGGG - Intronic
1047944507 8:129861548-129861570 TCTACTCTGGAGGCTGAGGTGGG - Intronic
1048338458 8:133520599-133520621 TCTAGACTGGAGGCTATGGTGGG - Intronic
1048469993 8:134697027-134697049 GCTACTCTGGAGGCTAAGGTGGG - Intronic
1048535093 8:135285958-135285980 TATTGTCTGAAGTCTATGATAGG + Intergenic
1049197280 8:141322773-141322795 TGTTCTCTGGAGACTAAGGAGGG - Intergenic
1049936014 9:502944-502966 GCTACTCTGGAGGCTAAGGTAGG - Intronic
1050130918 9:2411490-2411512 TCTTCTGTGAAGCATATGGTAGG + Intergenic
1050345965 9:4687565-4687587 GCTACTCTGGAGGCTAAGGTGGG + Intronic
1050350658 9:4738881-4738903 GCTTCTCTGGAGGCTGAGGTGGG - Intronic
1050820457 9:9872487-9872509 GCTACTCTGGAGTCTGAGGTGGG + Intronic
1051259145 9:15244995-15245017 TCTTCTCTGGGTTCTCTGGTTGG + Intronic
1051733766 9:20176605-20176627 TCTTCATCGGTGTCTATGGTTGG - Intergenic
1051757142 9:20414205-20414227 TGTTCTCTGGAGTCTTTAGAAGG + Exonic
1051793078 9:20830786-20830808 GCTACTCAGGAGTCTAAGGTGGG - Intronic
1053083423 9:35196880-35196902 GCTTCTCTGGAGGCTGAGGTGGG - Intronic
1053091827 9:35285603-35285625 GCTTCTCAGGAGGCTAGGGTAGG + Intronic
1053180984 9:35969998-35970020 GCTTCTCAGGAGGCTAAGGTAGG - Intergenic
1054912821 9:70469613-70469635 GCTACTCTGGAGTCTAAGGGAGG - Intergenic
1055768073 9:79686690-79686712 TCTTCCCTGGAGCCTTTGGAGGG + Intronic
1055810637 9:80143883-80143905 GCTACTCTGGAGTCTGAGGTGGG + Intergenic
1055959894 9:81810167-81810189 GCTACTCTGGAGGCTAAGGTGGG + Intergenic
1056005370 9:82264248-82264270 GCTACTCGGGAGACTATGGTGGG - Intergenic
1056943940 9:90977879-90977901 TCTCCTCTGGAGCCTGGGGTGGG - Intergenic
1057244779 9:93445700-93445722 TCTTCTCAGGAGGCTGAGGTGGG - Intergenic
1058301400 9:103378267-103378289 GCTACTCTGGAGGCTAAGGTGGG - Intergenic
1058673364 9:107379768-107379790 GCTACTCTGGAGGCTAAGGTGGG - Intergenic
1058952609 9:109917598-109917620 GCTACTCTGGAGGCTAAGGTGGG - Intronic
1058964200 9:110021316-110021338 TCTTCTCTAGAGCCTTTGGAGGG + Intronic
1059257178 9:112941504-112941526 TCTACTCTGGAGACTGAGGTGGG + Intergenic
1059447380 9:114347066-114347088 GCTTCTTTTGAGTCTATGGGAGG - Intronic
1059872271 9:118591022-118591044 TCTACTCTGGAGACTGAGGTAGG - Intergenic
1060476396 9:123990046-123990068 GCTACTCTGGAGTCTCAGGTAGG - Intergenic
1060634109 9:125186636-125186658 GCTTCTCAGGAGGCTAAGGTGGG + Intronic
1061126067 9:128676641-128676663 GCTACTCTGGAGGCTAGGGTAGG - Intergenic
1061290017 9:129645398-129645420 CCTTCTCTGGAGTCTTTGGAGGG - Intergenic
1061475205 9:130860729-130860751 ACTTCTCTAGAGTCCTTGGTAGG + Intronic
1203601798 Un_KI270748v1:17183-17205 TTTTCTTTGGAGTATATTGTTGG - Intergenic
1203685072 Un_KI270757v1:42268-42290 AGTTCTTTGGGGTCTATGGTAGG + Intergenic
1185679449 X:1876429-1876451 GCTACTCAGGAGGCTATGGTGGG - Intergenic
1185756130 X:2654590-2654612 TCTCCTCTGGAGGCTGAGGTGGG + Intergenic
1186147457 X:6639209-6639231 TCTACTCAGGAGGCTAAGGTGGG + Intergenic
1186242504 X:7584895-7584917 GCTACTCAGGAGGCTATGGTGGG - Intergenic
1186271147 X:7889735-7889757 GCTACTCAGGAGTCTAAGGTGGG - Intergenic
1186422748 X:9439417-9439439 GCTACTCAGGAGGCTATGGTGGG + Intergenic
1187725304 X:22196065-22196087 GCTACTCTGGAGGCTAAGGTGGG + Intronic
1187916132 X:24153659-24153681 CCTTCTCTGTCTTCTATGGTGGG + Intronic
1189154111 X:38738322-38738344 ACTTCTCTGGAGGCTGAGGTGGG - Intergenic
1189291324 X:39887928-39887950 TCTTCTCACAAGTCTTTGGTTGG - Intergenic
1190193301 X:48295075-48295097 GCTTCTCTGGAGGCTGAGGTGGG + Intergenic
1190204686 X:48393696-48393718 GCTTCTCTGGAGGCTGAGGTGGG - Intergenic
1190205850 X:48401707-48401729 GCTTCTCTGGAGGCTGAGGTGGG + Intergenic
1190659802 X:52643686-52643708 GCTTCTCTGCAGGCTAAGGTGGG + Intergenic
1190676926 X:52790658-52790680 GCTTCTCTGGAGGCTAAGGTGGG - Intergenic
1191752550 X:64558971-64558993 TCTACTCTGGAGGCTGAGGTAGG - Intergenic
1191873061 X:65766254-65766276 TCCTCCATGGTGTCTATGGTGGG + Intergenic
1192204131 X:69084959-69084981 GCTTCTCTGGAGGCTAAGGCAGG + Intergenic
1192584870 X:72311605-72311627 GCTACTCTGGAGGCTAAGGTGGG - Intergenic
1193925570 X:87479611-87479633 TGTTTTCTGGGGTCTGTGGTTGG + Intergenic
1195271881 X:103240211-103240233 ATTTATCTGGAGTCTCTGGTGGG - Intergenic
1196670507 X:118361642-118361664 GCTACTCTGGAGGCTAAGGTGGG + Intronic
1198281330 X:135145831-135145853 GCTACTCAGGAGGCTATGGTGGG - Intergenic
1198289629 X:135226685-135226707 GCTACTCAGGAGGCTATGGTGGG + Intergenic
1201051102 Y:9936394-9936416 TCTACTCAGAAGTCTAAGGTAGG - Intergenic