ID: 1013055784

View in Genome Browser
Species Human (GRCh38)
Location 6:106581587-106581609
Sequence CCTCTCCTGCACAAGCTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013055784_1013055786 -6 Left 1013055784 6:106581587-106581609 CCAAACAGCTTGTGCAGGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 155
Right 1013055786 6:106581604-106581626 GAGAGGAGAATCAAAGCACAAGG 0: 1
1: 0
2: 1
3: 37
4: 371
1013055784_1013055787 20 Left 1013055784 6:106581587-106581609 CCAAACAGCTTGTGCAGGAGAGG 0: 1
1: 0
2: 0
3: 8
4: 155
Right 1013055787 6:106581630-106581652 ATTTGCTCACTCAACCTCCTTGG 0: 1
1: 0
2: 2
3: 30
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013055784 Original CRISPR CCTCTCCTGCACAAGCTGTT TGG (reversed) Intronic
900671014 1:3854834-3854856 CCTCTTGTGCCCAGGCTGTTGGG + Intronic
900913112 1:5616280-5616302 ACTCTCCGGCACTGGCTGTTAGG + Intergenic
903507033 1:23843871-23843893 CCTCTCCTTCCCAAAGTGTTAGG + Intergenic
905402741 1:37715443-37715465 CCTCTCCTGAACATGCTGGCCGG + Intronic
905637347 1:39563608-39563630 CCTCACCTGCAGAGGCTGTATGG + Exonic
905925578 1:41747129-41747151 TCTCTCCTGCAGCAGGTGTTTGG - Intronic
907701243 1:56790227-56790249 GCTCTCCTCCACAAGCTGGAAGG + Intronic
908027188 1:59965545-59965567 CCTTTCCTGCACTTGCTGTGTGG + Intergenic
918521846 1:185423506-185423528 CCTCTGCAGCAGAAGCTCTTTGG - Intergenic
920420303 1:205828618-205828640 TCTCACCTGCACAAACTGTGAGG - Exonic
1065374987 10:25030535-25030557 CCTTTCCTGTAGAAGCTTTTAGG + Intronic
1070692991 10:78541530-78541552 ATTCTACTGCACATGCTGTTTGG - Intergenic
1072500006 10:96005413-96005435 CCTCTCATGGACAAGGTTTTAGG + Intronic
1073571238 10:104582743-104582765 CCTCCCCTGCACCTGCTGTGAGG + Intergenic
1074738883 10:116465064-116465086 CCTCTCATCCAAGAGCTGTTTGG - Intronic
1075047526 10:119158160-119158182 CCTCTCCTGCCCCAGCTCCTTGG - Intronic
1075132118 10:119748900-119748922 CCTCCACTGCCCAGGCTGTTTGG + Intronic
1075468436 10:122670056-122670078 CGCCACCTGCCCAAGCTGTTTGG + Intergenic
1075954906 10:126514989-126515011 CATCACCTGCACTAGCAGTTGGG - Intronic
1076576935 10:131475567-131475589 CCTCTCCTGCACAGACTGCCCGG + Intergenic
1076677253 10:132153528-132153550 CCTCTCCTGGAGAAGGTGTCAGG + Intronic
1077170529 11:1164016-1164038 CCCCTCCTGCTCAACCTGCTGGG - Intronic
1080100457 11:28453837-28453859 CCACTCCTGAAAAATCTGTTTGG + Intergenic
1083153505 11:60808733-60808755 CCTGCCCTGCCCAAGATGTTGGG - Intergenic
1087337734 11:96865746-96865768 CCTGTCCTGCACAGGCTATTAGG + Intergenic
1088017908 11:105082213-105082235 ACTCTCCTGCATAAGGTGTCTGG - Intronic
1090962925 11:131573118-131573140 CCTCTCCAGCACATGCTCCTGGG - Intronic
1092396762 12:8134041-8134063 CTTCTCCAGCCCAAGCTGCTGGG + Intronic
1092475642 12:8817073-8817095 CCTGTTCTACACAAGATGTTTGG - Intergenic
1097281761 12:57849098-57849120 CCTCTTCTTAACAAGCTGTGAGG - Intergenic
1100472823 12:94908897-94908919 CCCCACCTGCACCAGCTGCTAGG + Intronic
1101407719 12:104443363-104443385 CCTCTCCTCCAGAGGCTGTGGGG - Intergenic
1103184769 12:118946810-118946832 CCTCTCCTTCACATGATCTTGGG + Intergenic
1104113051 12:125722080-125722102 CTGCTCCTGGACAAGCTGATGGG + Intergenic
1104836591 12:131795888-131795910 CCTCTGCTGCAGAAGCTGCCAGG - Intronic
1108103536 13:46983752-46983774 CCTATCATGCACATGCTGTAAGG + Intergenic
1111576969 13:90167459-90167481 ACTTTCCTTCACAAACTGTTTGG - Intergenic
1112183586 13:97108012-97108034 CCTCTCCTGCCCAAGCCCTCGGG + Intergenic
1112923983 13:104650481-104650503 CCTCTCATTAACAAGTTGTTAGG + Intergenic
1114030381 14:18573377-18573399 CCTTTCCTACACATGATGTTGGG - Intergenic
1116600899 14:46921347-46921369 CCTCTGCTGCCCAAAGTGTTGGG - Intronic
1117512939 14:56471441-56471463 ACACTTCTGCACAAGCTGTCAGG - Intergenic
1118656942 14:67961254-67961276 CCTCTGCTTCCCAAACTGTTGGG + Intronic
1119380155 14:74223342-74223364 TCTCTCCTGCACCAGCTTTGGGG + Intergenic
1122555580 14:102577654-102577676 CCTCTTCTGCCCAAAGTGTTGGG - Intergenic
1122608525 14:102964540-102964562 CTCCTCCTGGACAAGCTGCTTGG + Exonic
1122814934 14:104307648-104307670 CCTCTCCTGCCCAGGCTGCCAGG - Intergenic
1124966371 15:34435977-34435999 CCTCTCCAGCCCAGGCTGTGGGG + Intronic
1126670406 15:51110698-51110720 CCTGCCCTGCACAAGCAGTGGGG + Intergenic
1127612669 15:60652060-60652082 CCTCTCCTTCACTTCCTGTTAGG + Intronic
1130706497 15:86237801-86237823 CCGCTTTTGCACAACCTGTTGGG + Intronic
1132785208 16:1653186-1653208 CCAGTCCTGCTCAAGCAGTTGGG - Intronic
1133326421 16:4944936-4944958 CCTCTCCTGCTCCAGCTGCCAGG - Intronic
1134991960 16:18708171-18708193 CTTCTCCAGCACATGGTGTTAGG + Intergenic
1136662169 16:31772345-31772367 ACTCTCCTGTATAAGCTGTCTGG - Intronic
1142045775 16:87924434-87924456 CCTCTAATGCACCTGCTGTTGGG - Intronic
1142683022 17:1561671-1561693 CCTCTTCCGCACCAGCTGCTTGG + Intronic
1144298063 17:13898176-13898198 CATGTCCTGTACAAGCTGTTGGG - Intergenic
1144676552 17:17165922-17165944 CCTCTCCTGCTCCAGCTGGGAGG - Intronic
1145941649 17:28745950-28745972 CCACTCCTGCCTGAGCTGTTAGG + Intronic
1147980276 17:44269818-44269840 CTTCTCCTGCTCCAGCTGGTGGG + Intergenic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1148202900 17:45761662-45761684 CCATCCCTGCACAAGCGGTTTGG + Intergenic
1153074285 18:1144891-1144913 ACTTTCATACACAAGCTGTTTGG + Intergenic
1156104255 18:33638311-33638333 CCTCTGCCGCACAAAATGTTGGG + Intronic
1160481284 18:79242000-79242022 CCTCTCCTGCACACACAGGTGGG - Intronic
1161382423 19:3972677-3972699 CCTTGGCTGCCCAAGCTGTTGGG - Intergenic
1161709573 19:5840386-5840408 CCTCTCCTTCCCAAACTGTTGGG - Intergenic
1166303347 19:41924049-41924071 CACCTCCCCCACAAGCTGTTTGG - Intronic
925428311 2:3769598-3769620 TCTCTCCAGCAGAAGCTGTGGGG - Intronic
926312845 2:11686854-11686876 CCTCTTCTGCCCCAGCTGCTGGG + Intronic
932534767 2:72581642-72581664 CATCTCCTGGACAAGGAGTTTGG + Intronic
932721076 2:74139352-74139374 GCTCTCATGCCCAGGCTGTTTGG - Intronic
934315329 2:91913015-91913037 CCTCAACTGCACAAGTAGTTGGG - Intergenic
935088397 2:99870389-99870411 CCTCTCCTCCACCTGCTGTGGGG - Intronic
935125185 2:100216697-100216719 CCTCTCCAGAAAAATCTGTTTGG + Intergenic
936921543 2:117694159-117694181 CCTCTCCTGCATAAGCTCTCCGG - Intergenic
938251848 2:129821681-129821703 CCTCTCCTGGACCTGCCGTTGGG - Intergenic
938307879 2:130267057-130267079 CCTCTCCTGCAACAGCTACTGGG + Intergenic
938447457 2:131389784-131389806 CCTCTCCTGCAACAGCTCCTGGG - Intergenic
939116387 2:138066238-138066260 CCTCTACTACATAAGCTGATAGG - Intergenic
941017268 2:160371654-160371676 CCTTTCCTGCACGAGTGGTTTGG + Intronic
943083227 2:183281695-183281717 CCTCTACTTCCCAAGGTGTTGGG + Intergenic
943755670 2:191554661-191554683 CCTCTCCTCCACACGTTCTTTGG - Intergenic
944235001 2:197434594-197434616 CCTCTTCTGCACAAACTATGGGG + Intronic
946608227 2:221429973-221429995 CCTGTCCTCTTCAAGCTGTTGGG + Exonic
947192682 2:227524929-227524951 CATCCCCAGCAAAAGCTGTTGGG - Intronic
1169132656 20:3173949-3173971 CCTCTCCCGCGCCAGCTCTTCGG + Intergenic
1173001540 20:39109412-39109434 CCTCACCTGTACAAGATGTCAGG - Intergenic
1173878699 20:46394203-46394225 CCTCTTCAACAAAAGCTGTTAGG - Intronic
1175205675 20:57309395-57309417 CCTCCCCTTCACAAACTGATGGG + Intergenic
1180454496 22:15500434-15500456 CCTTTCCTACACATGATGTTGGG - Intergenic
1180940371 22:19656805-19656827 GCCCTCCTGCACAGGCTGTGAGG - Intergenic
1181349159 22:22243212-22243234 CCTCCTCTGCACAGGCTGGTGGG - Intergenic
1182534365 22:30989460-30989482 CCTCTCCTTCTTAGGCTGTTAGG - Intergenic
1183686386 22:39363512-39363534 CCTCCCCAGCACCAGCTGCTGGG - Intronic
1185232563 22:49691574-49691596 CCTCTCCTCCCCACCCTGTTGGG - Intergenic
950525520 3:13520681-13520703 CCTGCCCTGCACATGCTGTGTGG + Intergenic
951679372 3:25278969-25278991 CCACTGCTGCACAATCTTTTAGG - Intronic
954806547 3:53224149-53224171 CTTCTTCTTCACAAGCTGTGTGG + Intergenic
955639579 3:61067829-61067851 CCTTTACTGAACAACCTGTTTGG + Intronic
956425551 3:69130711-69130733 CCTCTCCAGCACCTGTTGTTTGG + Intergenic
962805232 3:138922348-138922370 CCTCTCCAGGGCAAGCTGTCAGG - Intergenic
964144141 3:153438439-153438461 CCTTTCCTGCACAGGGTGATGGG - Intergenic
966296660 3:178432064-178432086 GCTTTCCTGCACAAGCTGTCGGG + Intronic
968000240 3:195200625-195200647 CCTGCCCTGCACAGGCTGTGAGG - Intronic
968594826 4:1476949-1476971 CCTCCCCTGCCCAGGCTGCTTGG + Intergenic
970086409 4:12352257-12352279 TCTCTCCTGCCCCAGCTATTGGG + Intergenic
973673535 4:53241081-53241103 CCTCTTCTGCAGGAGTTGTTGGG - Intronic
973925928 4:55737362-55737384 CCTCTCTTTCAAAAGCTATTGGG - Intergenic
974073861 4:57150961-57150983 CCTCCTCTGCAAATGCTGTTTGG + Intergenic
977918446 4:102618739-102618761 CCTTGCCTGCACAAGGTGCTTGG + Intergenic
977964900 4:103134287-103134309 CCTCTCCTGCCAACGCTGATTGG + Intronic
978054782 4:104249661-104249683 CCTCTTCTGCAGGAGCTGCTGGG + Intergenic
978346819 4:107779302-107779324 CCTATCCTGCAAATGCTATTTGG - Intergenic
985785791 5:1893457-1893479 CCATCCCTGCACAAGCTGGTGGG + Intergenic
989400707 5:41005016-41005038 CCTCCGCTGCACAAGCAGTGGGG - Intronic
995150220 5:108834663-108834685 CCTCTGTTGCCCAGGCTGTTAGG - Intronic
996529393 5:124511864-124511886 CCTCTCCTTCATAGGCTATTTGG + Intergenic
998251895 5:140558872-140558894 CCTGTCCTGCAGAAGCTTTCAGG - Intronic
998406965 5:141879384-141879406 CCTCTCCTGCGCTTGCGGTTTGG + Intergenic
1003831609 6:10017898-10017920 CATTTCTTGCACAAGCTCTTAGG - Intronic
1004509931 6:16277229-16277251 CCTCTCCTGCATCAGCTGTGGGG - Intronic
1005427426 6:25717212-25717234 CCTCTGCTGCAGTAGATGTTGGG - Intergenic
1005813902 6:29535151-29535173 CATCTCCTGGACATGCTGTCTGG - Intergenic
1007783772 6:44268856-44268878 CATCTCCTGCCCATGCTTTTTGG - Intergenic
1011232877 6:85183101-85183123 CCACTCCCACACAAACTGTTGGG + Intergenic
1011311923 6:85989049-85989071 CCTCACCAGCAAAAGCTGCTAGG + Intergenic
1013055784 6:106581587-106581609 CCTCTCCTGCACAAGCTGTTTGG - Intronic
1017186520 6:151606150-151606172 CCTGTGCTGCCCAAGCTGTTGGG + Intronic
1021485270 7:21160962-21160984 GCTGTCCTGGACAAGCTATTTGG + Intergenic
1022855177 7:34306634-34306656 TTTCTCCTGCAAAAGCTGTGAGG - Intergenic
1026389823 7:69889008-69889030 CCTCTCATTCTGAAGCTGTTGGG - Intronic
1026953049 7:74360254-74360276 CCTCTCCTCCTCCAGCTGGTTGG - Exonic
1029344006 7:99965761-99965783 CCTCTCCCTCCCAAGATGTTAGG + Intergenic
1031779441 7:125942743-125942765 CCTCTCCTGAGCAAGTTGTGAGG - Intergenic
1031968964 7:128049794-128049816 CCTCTCCTGCATACGTTGCTGGG - Intronic
1034509323 7:151520818-151520840 CCTATTCTGCCCAGGCTGTTTGG + Intergenic
1036663370 8:10722598-10722620 CCCCTCCTGCACAACGTGGTGGG + Intergenic
1045321135 8:101081985-101082007 CCTCTCCTGCAGAAGTGGGTAGG - Intergenic
1045891696 8:107165413-107165435 ACTTTCCTTCACAAGCTATTTGG - Intergenic
1046185318 8:110706994-110707016 CCTCTCCATCACAAGATATTAGG - Intergenic
1047673031 8:127169865-127169887 TATCTCCTTCTCAAGCTGTTTGG + Intergenic
1049220635 8:141427295-141427317 CCTTTCCTACACAAGATGTCAGG - Intronic
1049622386 8:143604569-143604591 CCTCACCTCCAGAGGCTGTTGGG + Exonic
1050601230 9:7253640-7253662 CCTCTCCAGCACCGGTTGTTTGG + Intergenic
1051744954 9:20286786-20286808 ACTCTCCTGAACAAAGTGTTTGG + Intergenic
1054714044 9:68539922-68539944 CCTCACCAACACTAGCTGTTTGG + Intronic
1055636847 9:78287458-78287480 TCTCTTCTGCCCAAGCTGGTTGG + Intergenic
1056778292 9:89530554-89530576 ACTCTCCAGGACAATCTGTTCGG - Intergenic
1057329621 9:94101320-94101342 CCCCTGCTTCACAAGCTGTTGGG - Intronic
1057741901 9:97719354-97719376 CATCTCCTGCACAATCTGCCAGG - Intergenic
1059258857 9:112956558-112956580 CCTCACTTGCACAAAATGTTTGG + Intergenic
1059441064 9:114307150-114307172 CCTCCTCTGCACAAGCGGCTGGG + Intronic
1059617085 9:115962827-115962849 ACTCTCCTGCACCCACTGTTCGG + Intergenic
1059939790 9:119347462-119347484 CGTGTCCTGCACATACTGTTTGG + Intronic
1060439635 9:123626775-123626797 CCTCTCCTGCACATGTGCTTAGG - Intronic
1061583551 9:131552634-131552656 TGTCTCCTGCACATGCAGTTTGG + Intergenic
1186471140 X:9822918-9822940 CATTTCCTGCCCAAGCAGTTAGG - Intronic
1186521696 X:10212214-10212236 CCTCTCCTTCAAAAGCTGGCTGG - Intronic
1191680716 X:63837260-63837282 CATCTCCAACCCAAGCTGTTTGG - Intergenic
1192737327 X:73861806-73861828 CCTCTGCAGGACAAGCTGCTGGG + Intergenic
1192978263 X:76309954-76309976 CCTATCCTGCACCCGCTGATAGG + Intergenic
1197720880 X:129743838-129743860 CCTCTCCTGAAGCAGCGGTTGGG - Intronic