ID: 1013057663

View in Genome Browser
Species Human (GRCh38)
Location 6:106600124-106600146
Sequence AGGAAGCCTCCAGCACCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013057661_1013057663 0 Left 1013057661 6:106600101-106600123 CCTAGTTCAGTCAGCAGACAGAC 0: 1
1: 0
2: 1
3: 12
4: 154
Right 1013057663 6:106600124-106600146 AGGAAGCCTCCAGCACCATCTGG No data
1013057660_1013057663 6 Left 1013057660 6:106600095-106600117 CCTTCACCTAGTTCAGTCAGCAG 0: 1
1: 1
2: 5
3: 74
4: 525
Right 1013057663 6:106600124-106600146 AGGAAGCCTCCAGCACCATCTGG No data
1013057658_1013057663 14 Left 1013057658 6:106600087-106600109 CCTCGCCTCCTTCACCTAGTTCA 0: 1
1: 0
2: 1
3: 18
4: 171
Right 1013057663 6:106600124-106600146 AGGAAGCCTCCAGCACCATCTGG No data
1013057659_1013057663 9 Left 1013057659 6:106600092-106600114 CCTCCTTCACCTAGTTCAGTCAG 0: 1
1: 0
2: 2
3: 8
4: 130
Right 1013057663 6:106600124-106600146 AGGAAGCCTCCAGCACCATCTGG No data
1013057656_1013057663 23 Left 1013057656 6:106600078-106600100 CCCAGGAATCCTCGCCTCCTTCA 0: 1
1: 0
2: 0
3: 14
4: 155
Right 1013057663 6:106600124-106600146 AGGAAGCCTCCAGCACCATCTGG No data
1013057657_1013057663 22 Left 1013057657 6:106600079-106600101 CCAGGAATCCTCGCCTCCTTCAC 0: 1
1: 0
2: 1
3: 11
4: 188
Right 1013057663 6:106600124-106600146 AGGAAGCCTCCAGCACCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013057663 Original CRISPR AGGAAGCCTCCAGCACCATC TGG Intronic
No off target data available for this crispr