ID: 1013070452

View in Genome Browser
Species Human (GRCh38)
Location 6:106724311-106724333
Sequence TTTTACAACTGGAAGAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013070444_1013070452 25 Left 1013070444 6:106724263-106724285 CCAACAGAGTTATGAGACAAAGA No data
Right 1013070452 6:106724311-106724333 TTTTACAACTGGAAGAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013070452 Original CRISPR TTTTACAACTGGAAGAGTGA TGG Intergenic
No off target data available for this crispr