ID: 1013072892

View in Genome Browser
Species Human (GRCh38)
Location 6:106744929-106744951
Sequence CTCACTCTGTGGCAAGTAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013072892_1013072902 26 Left 1013072892 6:106744929-106744951 CCAGTTACTTGCCACAGAGTGAG 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1013072902 6:106744978-106745000 ACTGAATCTCCCCTGAGGGTTGG 0: 1
1: 0
2: 1
3: 11
4: 164
1013072892_1013072900 21 Left 1013072892 6:106744929-106744951 CCAGTTACTTGCCACAGAGTGAG 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1013072900 6:106744973-106744995 AGTAGACTGAATCTCCCCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 106
1013072892_1013072901 22 Left 1013072892 6:106744929-106744951 CCAGTTACTTGCCACAGAGTGAG 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1013072901 6:106744974-106744996 GTAGACTGAATCTCCCCTGAGGG 0: 1
1: 0
2: 0
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013072892 Original CRISPR CTCACTCTGTGGCAAGTAAC TGG (reversed) Intergenic
902221494 1:14968729-14968751 CTCACTCTGTGGCAGGGAAAAGG - Intronic
902436258 1:16399858-16399880 CCTACTATGTGCCAAGTAACAGG - Intronic
902922976 1:19678493-19678515 CTCAGTCTGTGGCTAGGATCAGG + Intronic
906518840 1:46455656-46455678 CTCACTCTGTGGCCAGAGGCAGG + Intergenic
907075971 1:51578694-51578716 ATCACTCTGTGCCAGGTATCAGG + Intronic
908085803 1:60632584-60632606 CTCATTCTGAGGCAAGTATTAGG + Intergenic
908213662 1:61928697-61928719 CTCACTATGTGGCAGGTTAAAGG - Intronic
909044682 1:70695457-70695479 CTTTCTGTGTGGCAAGCAACGGG - Intergenic
909292644 1:73903036-73903058 CTCACTCTGTGGGAACTCAAAGG - Intergenic
909690650 1:78403769-78403791 CTCACTCTCTGGCACATAACAGG - Intronic
910522558 1:88139162-88139184 CTCACTCTGTGCCAAGTACTAGG - Intergenic
913660472 1:121002387-121002409 CCCACACTGTGGCAGGAAACAGG - Intergenic
914011835 1:143785544-143785566 CCCACACTGTGGCAGGAAACAGG - Intergenic
914165997 1:145175590-145175612 CCCACACTGTGGCAGGAAACAGG + Intergenic
914650463 1:149694203-149694225 CCCACACTGTGGCAGGAAACAGG - Intergenic
915001903 1:152601434-152601456 CTCATGCTCGGGCAAGTAACTGG + Intergenic
920066945 1:203275922-203275944 CACACGCTGTGGCAAGTGGCAGG - Intergenic
920313906 1:205064606-205064628 GTCACTCTGTGGCAAGGACAAGG - Exonic
922088552 1:222373799-222373821 GTGACTCTGGGGCATGTAACTGG - Intergenic
922407330 1:225328785-225328807 CTCACTAGGTCGTAAGTAACAGG + Intronic
924004037 1:239587235-239587257 GTCTCTCTGTGGCAAGTACGTGG - Intronic
1062971240 10:1651113-1651135 GTCATTCTGTGGCCAGTGACTGG - Intronic
1063006578 10:1977336-1977358 CTCACTCTGGGGTAAGTGATCGG - Intergenic
1063332331 10:5173342-5173364 CTCCCTCTCTGGGAAGTGACTGG - Intergenic
1063698969 10:8366226-8366248 CTCAGTTTGTGGAAAGTACCCGG - Intergenic
1065880686 10:30035188-30035210 CTCCCTCTGTAGGAAGTGACAGG - Intronic
1067013895 10:42741016-42741038 CTCACTCTGTTCCAGGTACCCGG - Intergenic
1068982920 10:63080446-63080468 CTCTCTCTCTTGCAAGTAATAGG - Intergenic
1069203509 10:65653411-65653433 CTAACTCTGGGGCTGGTAACAGG - Intergenic
1069407698 10:68119789-68119811 CTCAGTCTGTGGCAAGTAGGTGG + Intronic
1072820179 10:98548853-98548875 CTCTCACTGTGGCAGGTAAGAGG + Intronic
1074706184 10:116133922-116133944 CTCACACTGTCCCAAGTAAGAGG + Intronic
1076442539 10:130490093-130490115 CTCAGTCTGTGGGAGGCAACAGG - Intergenic
1077628621 11:3795614-3795636 CCTACTATGTGGCAAGCAACTGG + Intronic
1078525836 11:12100655-12100677 CTCACTGGGTGGAAAGGAACAGG + Intronic
1078884060 11:15482363-15482385 CTCACTCTGTGACATTTAGCAGG - Intergenic
1079085007 11:17439087-17439109 CCCACTCTGTGCCAAGCACCAGG - Intronic
1079989717 11:27233848-27233870 CTCACTCTGTGGCTAGTCCCTGG - Intergenic
1080838824 11:35965566-35965588 CTCACTATGTGCCGAGAAACTGG + Intronic
1083012343 11:59415178-59415200 CTCATTCTGTGGCAGGGACCTGG + Intergenic
1085339597 11:75722537-75722559 CTCACCCTGCGGCAAGTGTCTGG - Intronic
1086319981 11:85635515-85635537 CAAACTCTGTGGCATATAACAGG - Intronic
1087199064 11:95327533-95327555 CTCTCTCTGTGGGAAGTAATAGG - Intergenic
1089933363 11:122337453-122337475 CTTCCTCTGTGGCAGATAACGGG - Intergenic
1093876812 12:24358043-24358065 CACAGTGTGTGGCACGTAACGGG + Intergenic
1098138371 12:67427048-67427070 CTCTCTCTGTAGAAAGAAACTGG + Intergenic
1102731102 12:115110445-115110467 CACACTCTGTGGTCAGAAACTGG + Intergenic
1104358786 12:128112761-128112783 CTCACTCTGGGCCAAATAACAGG - Intergenic
1104588944 12:130069004-130069026 CTCACTCTGTGGCTTGTAGGTGG + Intergenic
1105350163 13:19607742-19607764 CTCATTCTGTGGTAGGTATCGGG - Intergenic
1108542432 13:51456494-51456516 CTCACTCCGTTGCATGGAACTGG + Intergenic
1109422255 13:62129410-62129432 CTCACTCTGGGGCAAAGAGCAGG - Intergenic
1110088194 13:71409071-71409093 CTCTTTCTGTTGCAACTAACTGG + Intergenic
1114570718 14:23665700-23665722 GTCACTCTGGGGCACGGAACAGG + Intergenic
1117300340 14:54419614-54419636 CACTTTCTGTAGCAAGTAACTGG - Intronic
1118356181 14:65015699-65015721 CTCACTCTGTAGCCACTATCTGG - Exonic
1119469087 14:74882289-74882311 CTAACTCTGAGTCAAGTATCTGG - Intronic
1122398860 14:101455321-101455343 CTCACTGTGTGGCATGTCTCTGG - Intergenic
1125095985 15:35852175-35852197 CTCATTCTGTGTGAAGTCACAGG + Intergenic
1126677271 15:51171384-51171406 CCCATTCTGTGACAAGCAACAGG - Intergenic
1127804989 15:62510848-62510870 ATCACTCTATAGCACGTAACTGG - Intronic
1127815154 15:62602003-62602025 CTCAGTCTGAGGCAAGAAATGGG - Intronic
1128630624 15:69262684-69262706 CTCATTCTGTAGCCAGTAGCTGG + Intronic
1131666282 15:94574316-94574338 CTCATACTTTGGCCAGTAACTGG - Intergenic
1133569646 16:7028090-7028112 GTCAAACTGTGCCAAGTAACAGG - Intronic
1134008564 16:10834562-10834584 CTCACTCTCTGGCAAACACCTGG + Intergenic
1134438371 16:14282302-14282324 CTCACTCTGTGGAAGGCAGCAGG + Intergenic
1134888416 16:17816233-17816255 CTATCTGTGTGGCAAGTAGCAGG - Intergenic
1142607955 17:1092346-1092368 CTCTCCCTGTGCCAAGTGACGGG - Intronic
1146479807 17:33196086-33196108 CTCACTCTGTGCCAGGTATCTGG - Intronic
1146507661 17:33419195-33419217 CTCCCTCTGGGGCAAGGAAGAGG - Intronic
1146550073 17:33772881-33772903 CTCATTCTTTGGGAAGTATCCGG - Intronic
1150142249 17:62739888-62739910 ATCACTCTGTGGCAACTCAGTGG - Intronic
1152607315 17:81298726-81298748 CTGTCTCTGAGGCAAGTGACTGG - Intergenic
1153954247 18:10082791-10082813 CTTTCTGTGTGGCAAGCAACAGG - Intergenic
1155557999 18:27043010-27043032 CTCACTCTGTGGCACTGGACAGG + Intronic
1157654442 18:49371057-49371079 CTCAGTCAGTGGCAAGGAATGGG + Intronic
1159217103 18:65407489-65407511 CTTTCTCTGTGGCAAGCAGCAGG - Intergenic
1159416159 18:68152205-68152227 CTCATTCTCTGGCAAGTTGCTGG - Intergenic
1159463114 18:68745098-68745120 CTACCTCTGTGGGGAGTAACTGG - Intronic
1159884734 18:73893288-73893310 GTCACCCTGTGCCAAGAAACAGG + Intergenic
1164586870 19:29481229-29481251 CTTTCTGTGTGGCAAGCAACAGG + Intergenic
1165535425 19:36440291-36440313 CTCAGTCTCTGCCAAGTGACTGG - Intergenic
1167823492 19:51951403-51951425 CTTTCTGTGTGGCAAGCAACGGG - Intergenic
925023152 2:587689-587711 CTCCCTCCGTGGCATGAAACCGG - Intergenic
925069828 2:957502-957524 CTCAGTGTGTGGCAATTAATAGG - Intronic
925987209 2:9226097-9226119 CTCACCCTGGGGCACGTAAGAGG + Intronic
926671253 2:15578876-15578898 CTTACACAGTGGCAAGAAACAGG - Intergenic
928211168 2:29324988-29325010 CTCACTCTGGGCAACGTAACTGG - Intronic
928672744 2:33619177-33619199 CTTTCTGTGTGGCAAGTAATGGG - Intergenic
928681623 2:33708582-33708604 ATAACTCTGTGGCCAGTCACTGG + Intergenic
928936451 2:36683919-36683941 CTCACTGTGTGGCTATAAACAGG + Intergenic
929104005 2:38346247-38346269 CTCACACTGTAGCATCTAACTGG + Intronic
933463404 2:82619285-82619307 CTTTCTGTGTGGCAAGTAGCAGG + Intergenic
935584487 2:104788462-104788484 CTCACTCTATGTCCAGTAAGGGG - Intergenic
936978552 2:118242763-118242785 CTCACTCCTGGGCAAGTATCAGG + Intergenic
939136697 2:138304418-138304440 CTTCCTCTGTGGCCAGTATCTGG + Intergenic
943259309 2:185638577-185638599 CTATATCTGTAGCAAGTAACAGG + Intergenic
944068626 2:195645971-195645993 CTCACTCTGTGTCAAAAAAAAGG + Intronic
944489478 2:200243352-200243374 CCCTCTCTGTGGCACTTAACTGG + Intergenic
1168847089 20:952652-952674 CTCACTCTTTGGCAGGCAGCTGG + Intergenic
1169899849 20:10541873-10541895 CTGGCTCTGTGGCCAGTAAAGGG + Intronic
1180968187 22:19801324-19801346 CTCACTCTGGTGCAAGTCTCAGG - Intronic
1182987704 22:34736499-34736521 CTCACTCTTTTGCCAGTAGCTGG + Intergenic
1184869111 22:47222330-47222352 CTCACTGTGTGGCAGGTACTGGG - Intergenic
951443209 3:22746750-22746772 CTCACTCTAAGGTAAGTAACAGG + Intergenic
951718403 3:25673362-25673384 CTCACAATGTGGCAAGCAAGGGG + Intergenic
954511046 3:51125807-51125829 TTCACGTTGTGGCAAGGAACTGG + Intronic
955237360 3:57151200-57151222 ATCACTCTGGGGCTAGAAACTGG - Intronic
955620437 3:60857551-60857573 CTAACTCTGTGGCAAGCACTGGG - Intronic
956344808 3:68266710-68266732 CTCACTATGTGCCAAGCATCTGG - Intronic
958019591 3:87980042-87980064 CCCACACTGTGGCAAGCAGCAGG + Intergenic
969278607 4:6153960-6153982 CAGACTCTGTGACAAGTAAGAGG - Intronic
970224512 4:13843760-13843782 CCCACTCTGTAGCAAGTTGCAGG + Intergenic
973366314 4:49212071-49212093 CTGACTCTGTTGCATGTCACTGG - Intergenic
974591878 4:63960924-63960946 TTCACTCTATGACAGGTAACTGG - Intergenic
976080760 4:81352238-81352260 CTCCCTCTGTGACATGTAAAAGG - Intergenic
977400769 4:96529132-96529154 CTCTATCACTGGCAAGTAACTGG + Intergenic
981062099 4:140435933-140435955 CTGAACCTGTGGCAAGTTACAGG - Intergenic
983563716 4:169127739-169127761 CTCACTCTGAGGCAAATCAATGG - Intronic
983715519 4:170776877-170776899 CCCACAGTGTGGCAAGCAACGGG - Intergenic
987285660 5:16454133-16454155 CTCACTCTGTTACAAGTTAGTGG - Intronic
987325350 5:16807288-16807310 GTCACTATGTGTGAAGTAACAGG - Intronic
989104586 5:37849601-37849623 CTCGCTCTGTGGTAATTACCAGG - Intergenic
989426421 5:41301044-41301066 CTCACTGTGGAGGAAGTAACAGG - Intergenic
990201905 5:53385485-53385507 CTCACTCTGTGGGTAATACCCGG + Intergenic
996899092 5:128523067-128523089 CTTACTTTGTGCCAGGTAACAGG + Intronic
998623350 5:143818732-143818754 CTCGCTATGTGTCAAGCAACTGG - Intronic
999654561 5:153799349-153799371 CTCACTCTGTGGGAATAAAATGG - Intronic
1001012776 5:168113551-168113573 TTTACTCAGTGGGAAGTAACAGG - Intronic
1003866110 6:10364262-10364284 CTTTCTCTGCGGCAAGCAACAGG - Intergenic
1004616412 6:17294677-17294699 CTGGCTCTGTGGCAAGTAGTTGG - Intergenic
1008826787 6:55704698-55704720 CTCAGTCTCTGGCAAGAACCAGG + Intergenic
1009563015 6:65273410-65273432 TTCACTCTAAGGAAAGTAACAGG + Intronic
1010454293 6:76037393-76037415 CTCACACTGGGGGAAATAACAGG + Intronic
1010939196 6:81896022-81896044 CTCATTCTGTGGCAAATACTAGG + Intergenic
1010989915 6:82469120-82469142 CTTTCTGTGTGGCAAGCAACAGG + Intergenic
1011404280 6:87001457-87001479 CTTTCTCTGTGGCAAGCAGCAGG - Intronic
1012098409 6:94995959-94995981 TTCACGTTGTGGCAAATAACAGG - Intergenic
1013005886 6:106072988-106073010 TTCACCATGTGGCAATTAACAGG + Intergenic
1013072892 6:106744929-106744951 CTCACTCTGTGGCAAGTAACTGG - Intergenic
1016232755 6:141826717-141826739 CTTTCTCTGTGGCAAACAACAGG - Intergenic
1017564622 6:155670079-155670101 CTCACTCTGTAGCAACTCCCAGG + Intergenic
1019256458 7:55447-55469 CTCACCCTGTGGCCATTACCTGG - Intergenic
1021683520 7:23158561-23158583 CACACTCTGTTGTTAGTAACAGG - Intronic
1023600839 7:41880425-41880447 CTCACTCTTTGTCAAGAAAGGGG + Intergenic
1023779590 7:43643467-43643489 CTCACTCTGTGCCAGGCCACCGG - Intronic
1026146760 7:67753363-67753385 CTAATTTTGTGGCAAGTCACAGG + Intergenic
1030520137 7:110588530-110588552 CTCATTCTAGGGCAATTAACTGG - Intergenic
1031487995 7:122352872-122352894 TTCACTCTGTGGAAGGCAACTGG + Intronic
1042397292 8:68307107-68307129 CTTTCTGTGTGGCAAGTAGCAGG + Intronic
1042818427 8:72903626-72903648 CTCACTCTCTGGCCAGGAACTGG - Intronic
1044494529 8:92861156-92861178 TTCACTCTGTGCCAAGTGCCAGG - Intergenic
1046324797 8:112627843-112627865 CACAAACTTTGGCAAGTAACAGG - Intronic
1046403699 8:113743057-113743079 ATTACTCTGTGTCAAATAACAGG - Intergenic
1048458957 8:134603803-134603825 CTCACTCTGCAGGCAGTAACAGG + Intronic
1048897170 8:139002285-139002307 CCCAGTCTGTGACAAGTAAAGGG - Intergenic
1058055012 9:100440556-100440578 ATCACTCTGTGGCATGTACCTGG - Intronic
1060020865 9:120129974-120129996 CTCACTTTGTAGCAATTGACTGG - Intergenic
1060518526 9:124280679-124280701 CTCGCTCTGTGGCTAGGCACGGG + Intronic
1061374810 9:130217553-130217575 CTCACTCTGTGTGCAGTATCTGG + Intronic
1185833749 X:3325150-3325172 CACACTGTGTGGTAACTAACGGG + Intronic
1187674785 X:21705190-21705212 CTGACTCTGTGGCCAGTCACAGG + Intergenic
1190047610 X:47125283-47125305 CTCCCTCTGGGGCAAAAAACAGG - Intergenic
1192196549 X:69032614-69032636 CTCACTCCTTGCCAGGTAACTGG + Intergenic
1192801510 X:74469127-74469149 CTCACGTTGTTGCAAGTGACAGG + Intronic
1193027300 X:76858296-76858318 CTGACTCTGTGTCACCTAACTGG + Intergenic
1194942471 X:100027708-100027730 CAAAATCTGTGTCAAGTAACAGG + Intergenic
1195171445 X:102272522-102272544 CTGCCTCTGTGGGAAGGAACAGG - Intergenic
1195187415 X:102414577-102414599 CTGCCTCTGTGGGAAGGAACAGG + Intronic
1195824396 X:108982381-108982403 CTCAATTTGTGAAAAGTAACTGG + Intergenic
1201167424 Y:11222082-11222104 CCCACAATGTGGCAAGTAAGGGG + Intergenic