ID: 1013073469

View in Genome Browser
Species Human (GRCh38)
Location 6:106750310-106750332
Sequence GAGTGGTGCAGGGAGGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013073469_1013073478 14 Left 1013073469 6:106750310-106750332 CCAGCAGCCTCCCTGCACCACTC No data
Right 1013073478 6:106750347-106750369 CGTCCCAACGCACTGCAGTGCGG No data
1013073469_1013073479 15 Left 1013073469 6:106750310-106750332 CCAGCAGCCTCCCTGCACCACTC No data
Right 1013073479 6:106750348-106750370 GTCCCAACGCACTGCAGTGCGGG No data
1013073469_1013073483 20 Left 1013073469 6:106750310-106750332 CCAGCAGCCTCCCTGCACCACTC No data
Right 1013073483 6:106750353-106750375 AACGCACTGCAGTGCGGGGAAGG No data
1013073469_1013073480 16 Left 1013073469 6:106750310-106750332 CCAGCAGCCTCCCTGCACCACTC No data
Right 1013073480 6:106750349-106750371 TCCCAACGCACTGCAGTGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013073469 Original CRISPR GAGTGGTGCAGGGAGGCTGC TGG (reversed) Intergenic
No off target data available for this crispr