ID: 1013076691

View in Genome Browser
Species Human (GRCh38)
Location 6:106778036-106778058
Sequence TTCTGCTGATGAAGAAAATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013076691_1013076694 -10 Left 1013076691 6:106778036-106778058 CCTCATTTTCTTCATCAGCAGAA No data
Right 1013076694 6:106778049-106778071 ATCAGCAGAATAGAGAGGAAGGG No data
1013076691_1013076696 24 Left 1013076691 6:106778036-106778058 CCTCATTTTCTTCATCAGCAGAA No data
Right 1013076696 6:106778083-106778105 GTTCCCAAACTTGTCTGTTTTGG No data
1013076691_1013076698 27 Left 1013076691 6:106778036-106778058 CCTCATTTTCTTCATCAGCAGAA No data
Right 1013076698 6:106778086-106778108 CCCAAACTTGTCTGTTTTGGAGG No data
1013076691_1013076695 2 Left 1013076691 6:106778036-106778058 CCTCATTTTCTTCATCAGCAGAA No data
Right 1013076695 6:106778061-106778083 GAGAGGAAGGGCTAGAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013076691 Original CRISPR TTCTGCTGATGAAGAAAATG AGG (reversed) Intergenic
No off target data available for this crispr