ID: 1013076698

View in Genome Browser
Species Human (GRCh38)
Location 6:106778086-106778108
Sequence CCCAAACTTGTCTGTTTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013076691_1013076698 27 Left 1013076691 6:106778036-106778058 CCTCATTTTCTTCATCAGCAGAA No data
Right 1013076698 6:106778086-106778108 CCCAAACTTGTCTGTTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013076698 Original CRISPR CCCAAACTTGTCTGTTTTGG AGG Intergenic
No off target data available for this crispr