ID: 1013081222

View in Genome Browser
Species Human (GRCh38)
Location 6:106815184-106815206
Sequence TCCTCTCTTGTGGGCATCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013081222_1013081231 22 Left 1013081222 6:106815184-106815206 CCTTTGATGCCCACAAGAGAGGA No data
Right 1013081231 6:106815229-106815251 TAAGACTCCTTGGGAGAAACAGG No data
1013081222_1013081228 12 Left 1013081222 6:106815184-106815206 CCTTTGATGCCCACAAGAGAGGA No data
Right 1013081228 6:106815219-106815241 TCTGATGGCCTAAGACTCCTTGG No data
1013081222_1013081226 -3 Left 1013081222 6:106815184-106815206 CCTTTGATGCCCACAAGAGAGGA No data
Right 1013081226 6:106815204-106815226 GGACCTCAGGCAATTTCTGATGG No data
1013081222_1013081229 13 Left 1013081222 6:106815184-106815206 CCTTTGATGCCCACAAGAGAGGA No data
Right 1013081229 6:106815220-106815242 CTGATGGCCTAAGACTCCTTGGG No data
1013081222_1013081232 25 Left 1013081222 6:106815184-106815206 CCTTTGATGCCCACAAGAGAGGA No data
Right 1013081232 6:106815232-106815254 GACTCCTTGGGAGAAACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013081222 Original CRISPR TCCTCTCTTGTGGGCATCAA AGG (reversed) Intergenic
No off target data available for this crispr