ID: 1013081224

View in Genome Browser
Species Human (GRCh38)
Location 6:106815193-106815215
Sequence TGCCTGAGGTCCTCTCTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013081224_1013081229 4 Left 1013081224 6:106815193-106815215 CCCACAAGAGAGGACCTCAGGCA No data
Right 1013081229 6:106815220-106815242 CTGATGGCCTAAGACTCCTTGGG No data
1013081224_1013081232 16 Left 1013081224 6:106815193-106815215 CCCACAAGAGAGGACCTCAGGCA No data
Right 1013081232 6:106815232-106815254 GACTCCTTGGGAGAAACAGGAGG No data
1013081224_1013081228 3 Left 1013081224 6:106815193-106815215 CCCACAAGAGAGGACCTCAGGCA No data
Right 1013081228 6:106815219-106815241 TCTGATGGCCTAAGACTCCTTGG No data
1013081224_1013081231 13 Left 1013081224 6:106815193-106815215 CCCACAAGAGAGGACCTCAGGCA No data
Right 1013081231 6:106815229-106815251 TAAGACTCCTTGGGAGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013081224 Original CRISPR TGCCTGAGGTCCTCTCTTGT GGG (reversed) Intergenic
No off target data available for this crispr