ID: 1013081225

View in Genome Browser
Species Human (GRCh38)
Location 6:106815194-106815216
Sequence TTGCCTGAGGTCCTCTCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013081225_1013081228 2 Left 1013081225 6:106815194-106815216 CCACAAGAGAGGACCTCAGGCAA No data
Right 1013081228 6:106815219-106815241 TCTGATGGCCTAAGACTCCTTGG No data
1013081225_1013081231 12 Left 1013081225 6:106815194-106815216 CCACAAGAGAGGACCTCAGGCAA No data
Right 1013081231 6:106815229-106815251 TAAGACTCCTTGGGAGAAACAGG No data
1013081225_1013081232 15 Left 1013081225 6:106815194-106815216 CCACAAGAGAGGACCTCAGGCAA No data
Right 1013081232 6:106815232-106815254 GACTCCTTGGGAGAAACAGGAGG No data
1013081225_1013081229 3 Left 1013081225 6:106815194-106815216 CCACAAGAGAGGACCTCAGGCAA No data
Right 1013081229 6:106815220-106815242 CTGATGGCCTAAGACTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013081225 Original CRISPR TTGCCTGAGGTCCTCTCTTG TGG (reversed) Intergenic
No off target data available for this crispr