ID: 1013081227

View in Genome Browser
Species Human (GRCh38)
Location 6:106815207-106815229
Sequence AGGCCATCAGAAATTGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013081227_1013081229 -10 Left 1013081227 6:106815207-106815229 CCTCAGGCAATTTCTGATGGCCT No data
Right 1013081229 6:106815220-106815242 CTGATGGCCTAAGACTCCTTGGG No data
1013081227_1013081232 2 Left 1013081227 6:106815207-106815229 CCTCAGGCAATTTCTGATGGCCT No data
Right 1013081232 6:106815232-106815254 GACTCCTTGGGAGAAACAGGAGG No data
1013081227_1013081234 22 Left 1013081227 6:106815207-106815229 CCTCAGGCAATTTCTGATGGCCT No data
Right 1013081234 6:106815252-106815274 AGGTGCCACAGACCCCATTGTGG No data
1013081227_1013081231 -1 Left 1013081227 6:106815207-106815229 CCTCAGGCAATTTCTGATGGCCT No data
Right 1013081231 6:106815229-106815251 TAAGACTCCTTGGGAGAAACAGG No data
1013081227_1013081235 23 Left 1013081227 6:106815207-106815229 CCTCAGGCAATTTCTGATGGCCT No data
Right 1013081235 6:106815253-106815275 GGTGCCACAGACCCCATTGTGGG No data
1013081227_1013081237 30 Left 1013081227 6:106815207-106815229 CCTCAGGCAATTTCTGATGGCCT No data
Right 1013081237 6:106815260-106815282 CAGACCCCATTGTGGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013081227 Original CRISPR AGGCCATCAGAAATTGCCTG AGG (reversed) Intergenic
No off target data available for this crispr