ID: 1013081229

View in Genome Browser
Species Human (GRCh38)
Location 6:106815220-106815242
Sequence CTGATGGCCTAAGACTCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013081227_1013081229 -10 Left 1013081227 6:106815207-106815229 CCTCAGGCAATTTCTGATGGCCT No data
Right 1013081229 6:106815220-106815242 CTGATGGCCTAAGACTCCTTGGG No data
1013081220_1013081229 16 Left 1013081220 6:106815181-106815203 CCACCTTTGATGCCCACAAGAGA No data
Right 1013081229 6:106815220-106815242 CTGATGGCCTAAGACTCCTTGGG No data
1013081222_1013081229 13 Left 1013081222 6:106815184-106815206 CCTTTGATGCCCACAAGAGAGGA No data
Right 1013081229 6:106815220-106815242 CTGATGGCCTAAGACTCCTTGGG No data
1013081224_1013081229 4 Left 1013081224 6:106815193-106815215 CCCACAAGAGAGGACCTCAGGCA No data
Right 1013081229 6:106815220-106815242 CTGATGGCCTAAGACTCCTTGGG No data
1013081225_1013081229 3 Left 1013081225 6:106815194-106815216 CCACAAGAGAGGACCTCAGGCAA No data
Right 1013081229 6:106815220-106815242 CTGATGGCCTAAGACTCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013081229 Original CRISPR CTGATGGCCTAAGACTCCTT GGG Intergenic
No off target data available for this crispr