ID: 1013086330

View in Genome Browser
Species Human (GRCh38)
Location 6:106861080-106861102
Sequence CAGGATAAGCAGCTGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013086330_1013086335 16 Left 1013086330 6:106861080-106861102 CCTCTCTGCAGCTGCTTATCCTG No data
Right 1013086335 6:106861119-106861141 GCAGAAAGGAGGCCCTGGAGAGG No data
1013086330_1013086336 17 Left 1013086330 6:106861080-106861102 CCTCTCTGCAGCTGCTTATCCTG No data
Right 1013086336 6:106861120-106861142 CAGAAAGGAGGCCCTGGAGAGGG No data
1013086330_1013086333 5 Left 1013086330 6:106861080-106861102 CCTCTCTGCAGCTGCTTATCCTG No data
Right 1013086333 6:106861108-106861130 TACAGCTCTCAGCAGAAAGGAGG No data
1013086330_1013086332 2 Left 1013086330 6:106861080-106861102 CCTCTCTGCAGCTGCTTATCCTG No data
Right 1013086332 6:106861105-106861127 GTCTACAGCTCTCAGCAGAAAGG No data
1013086330_1013086334 11 Left 1013086330 6:106861080-106861102 CCTCTCTGCAGCTGCTTATCCTG No data
Right 1013086334 6:106861114-106861136 TCTCAGCAGAAAGGAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013086330 Original CRISPR CAGGATAAGCAGCTGCAGAG AGG (reversed) Intergenic
No off target data available for this crispr