ID: 1013097788

View in Genome Browser
Species Human (GRCh38)
Location 6:106961752-106961774
Sequence GTATAGCCCAGATGTGCAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013097787_1013097788 -1 Left 1013097787 6:106961730-106961752 CCTAGGAGCAATGGACTATTGCG No data
Right 1013097788 6:106961752-106961774 GTATAGCCCAGATGTGCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013097788 Original CRISPR GTATAGCCCAGATGTGCAAT AGG Intergenic
No off target data available for this crispr