ID: 1013099085

View in Genome Browser
Species Human (GRCh38)
Location 6:106973393-106973415
Sequence CTCAATTCTTTGATGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 185}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013099085_1013099098 7 Left 1013099085 6:106973393-106973415 CCCTCCCCCATCAAAGAATTGAG 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1013099098 6:106973423-106973445 CGGGAGCGCAGCGGACTGGGAGG 0: 1
1: 0
2: 0
3: 16
4: 166
1013099085_1013099099 18 Left 1013099085 6:106973393-106973415 CCCTCCCCCATCAAAGAATTGAG 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1013099099 6:106973434-106973456 CGGACTGGGAGGAAGACAATAGG 0: 1
1: 0
2: 0
3: 11
4: 173
1013099085_1013099096 3 Left 1013099085 6:106973393-106973415 CCCTCCCCCATCAAAGAATTGAG 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1013099096 6:106973419-106973441 GGCTCGGGAGCGCAGCGGACTGG 0: 1
1: 0
2: 0
3: 11
4: 103
1013099085_1013099095 -2 Left 1013099085 6:106973393-106973415 CCCTCCCCCATCAAAGAATTGAG 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1013099095 6:106973414-106973436 AGGAAGGCTCGGGAGCGCAGCGG 0: 1
1: 0
2: 0
3: 16
4: 241
1013099085_1013099100 19 Left 1013099085 6:106973393-106973415 CCCTCCCCCATCAAAGAATTGAG 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1013099100 6:106973435-106973457 GGACTGGGAGGAAGACAATAGGG 0: 1
1: 0
2: 3
3: 38
4: 357
1013099085_1013099097 4 Left 1013099085 6:106973393-106973415 CCCTCCCCCATCAAAGAATTGAG 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1013099097 6:106973420-106973442 GCTCGGGAGCGCAGCGGACTGGG 0: 1
1: 0
2: 0
3: 4
4: 48
1013099085_1013099101 24 Left 1013099085 6:106973393-106973415 CCCTCCCCCATCAAAGAATTGAG 0: 1
1: 0
2: 0
3: 15
4: 185
Right 1013099101 6:106973440-106973462 GGGAGGAAGACAATAGGGTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013099085 Original CRISPR CTCAATTCTTTGATGGGGGA GGG (reversed) Intronic
900461070 1:2802325-2802347 CTCAACCCTGTGATGGGGGAGGG - Intergenic
901383896 1:8893924-8893946 CTTCATTGTTTGTTGGGGGAGGG + Intergenic
903496154 1:23768798-23768820 GATAATTCTTTGTTGGGGGAGGG - Intergenic
905258021 1:36697636-36697658 CTCCTTTCTTTGATCAGGGATGG - Intergenic
906109912 1:43315747-43315769 CTCACTGCTGTGGTGGGGGAGGG + Intronic
908543838 1:65146507-65146529 CTCAGCTCTTTGATTGGGGTTGG - Intergenic
908561089 1:65307907-65307929 CTGCATTCTTTGATGAGGTATGG - Intronic
909509556 1:76436723-76436745 CTCAATTCCTTGTAAGGGGAGGG - Intronic
911710354 1:101064535-101064557 CTCAATTTTTTGGTGGGGACGGG + Intergenic
914241309 1:145854853-145854875 CCCCATTCTTGGTTGGGGGAAGG + Exonic
915102104 1:153508028-153508050 CTCACTTGGTTGAAGGGGGAAGG - Intergenic
915121226 1:153630483-153630505 CTCACTTCCATGATGGGGGTGGG + Intronic
916053581 1:161052536-161052558 CTCCATTCTTTGTAGGAGGAAGG - Exonic
919975304 1:202606708-202606730 ATCACATCTTTGATGCGGGAAGG - Intronic
920166236 1:204038050-204038072 CTCAATGCTAGGGTGGGGGATGG + Intergenic
922181814 1:223241821-223241843 CTCCTTTCTTTGATAGTGGATGG - Intronic
1063274455 10:4549579-4549601 CTGAATTCTTTCCTGGGTGAAGG + Intergenic
1064016086 10:11773366-11773388 TTCACTTCTTTGCTGAGGGAGGG - Intergenic
1066043401 10:31576018-31576040 TTCAATTCTTTGAAGGCTGAGGG + Intergenic
1066694676 10:38067174-38067196 GTGTATTCATTGATGGGGGAAGG - Intergenic
1069809618 10:71148742-71148764 CTCCATTCCTTAAAGGGGGAGGG - Intergenic
1070294239 10:75145652-75145674 AATAATTCTTTGTTGGGGGAGGG + Intronic
1070804723 10:79264365-79264387 CTCAATCTATTGCTGGGGGAGGG + Intronic
1071600000 10:86954400-86954422 CGCATTTCGATGATGGGGGAAGG - Intronic
1071871659 10:89801923-89801945 GTCATTTCTTTGCTGGTGGAGGG + Intergenic
1072686351 10:97539681-97539703 CTCAAGCCTTTCTTGGGGGAGGG + Intronic
1072775461 10:98187505-98187527 ATCAATTCTTTGATGGTGGCAGG + Intronic
1072977581 10:100072532-100072554 CTAAATTTTTTGAAGGGGGGAGG - Intronic
1076263454 10:129090625-129090647 CTCAATTCTTTGAGACTGGATGG - Intergenic
1076363481 10:129906702-129906724 CTCAATTGTTTGATTGAGAAGGG + Intronic
1076445020 10:130508579-130508601 CTCAATTCTCACGTGGGGGAAGG - Intergenic
1076588128 10:131563905-131563927 CTGAATTGTTGGAAGGGGGATGG - Intergenic
1079130613 11:17744873-17744895 CTCGATTCTTAGATCAGGGAGGG + Intronic
1079776403 11:24535669-24535691 TTCAATACTTTAATGGAGGAAGG - Intronic
1080137400 11:28871799-28871821 GTTAATTCTATGATTGGGGAGGG - Intergenic
1080757241 11:35213645-35213667 TTCAGTTCTTTTTTGGGGGACGG - Intronic
1081985103 11:47296083-47296105 ACCATTTCTTTAATGGGGGAGGG + Intronic
1084905948 11:72347535-72347557 GACAATTCTTTGATTGGAGATGG + Intronic
1088499616 11:110470419-110470441 CATAATTCTGTTATGGGGGAAGG + Intergenic
1090712240 11:129397728-129397750 ACCAATTCCATGATGGGGGAAGG + Intronic
1095729076 12:45485956-45485978 CTCAGTTCTGTGAAGGGTGAGGG + Intergenic
1096682697 12:53267460-53267482 CTGAATTCTTTGGTGGAGGAAGG + Intergenic
1097581327 12:61460508-61460530 CTCAACTCTTTGATGGGGATAGG + Intergenic
1098446605 12:70572464-70572486 CTCATTTTTTTGAGGGGGGCGGG - Intronic
1098867719 12:75781769-75781791 CTCAATTCTAGAATGGGGTATGG + Intergenic
1099688063 12:85914441-85914463 CTGAGTTCCTTGGTGGGGGAGGG + Intergenic
1099952391 12:89318660-89318682 CTCAATTGTTTGCGGGGGAAGGG - Intergenic
1103360807 12:120352553-120352575 CTCAATAATCTCATGGGGGAAGG - Intronic
1103409918 12:120703539-120703561 CTCTCTTCCTTTATGGGGGATGG - Intergenic
1107036151 13:35904764-35904786 CTCAATGCTTTGCTCGGGCACGG + Intronic
1108238671 13:48437606-48437628 CTCAGTTCTTTGCTGGCTGATGG + Intronic
1109464904 13:62717562-62717584 CTCAATTTTTTTATGGGGTATGG - Intergenic
1112285291 13:98098657-98098679 TTCAATTTTTTGTGGGGGGAGGG - Intergenic
1114364630 14:22013252-22013274 CTCGATTCATTGATGGGGGCAGG - Intergenic
1116293889 14:43079383-43079405 AACAATTCTTTGTTGGGGGATGG + Intergenic
1119365708 14:74089872-74089894 CTCAATCCTCTTATGGGAGAGGG + Intronic
1119922534 14:78459625-78459647 CTCAATTTTTTATTGGGTGATGG + Intronic
1120385325 14:83838646-83838668 CTTAATTGTCTGATGGGGGTGGG - Intergenic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1124701604 15:31918196-31918218 CTCAGTTCTCTGATGGGTTAAGG + Intergenic
1125360398 15:38858579-38858601 CTCATTTCTTTCTTGGGGGAAGG - Intergenic
1125761444 15:42098641-42098663 CTCTATTTTTTGATGGGGAGTGG - Intergenic
1126011445 15:44306372-44306394 TTCAATTCTATGAAGGGTGAAGG - Intronic
1127626797 15:60787804-60787826 CTCAATGCCTTGTTTGGGGAAGG - Intronic
1130316112 15:82798462-82798484 CACAATTTTTTAATGGGGGTAGG - Intronic
1130912632 15:88281571-88281593 CTCTATCCTTTGTTTGGGGATGG - Intergenic
1131511891 15:93053758-93053780 CTCAAGTCTGTGATCTGGGAAGG - Intronic
1132828424 16:1916329-1916351 CTCATTTTTTAGAAGGGGGAGGG - Intronic
1135825431 16:25723132-25723154 CACAATTCCCTCATGGGGGAGGG - Intronic
1140213259 16:72987391-72987413 CTCCATGCTTTGATCGGGGAGGG - Intronic
1142980091 17:3666667-3666689 CTCGAGTCTTGGATTGGGGATGG - Intronic
1144110318 17:12024240-12024262 CTCATTTTTTTCATAGGGGATGG + Intronic
1149731241 17:58948197-58948219 CTCTATTTTTTTATGGGGAATGG + Intronic
1150455689 17:65304941-65304963 CTCAAGTGTGGGATGGGGGAAGG + Intergenic
1150913764 17:69414958-69414980 CCCTTTCCTTTGATGGGGGAGGG - Exonic
1158932275 18:62333705-62333727 GTCAACTCTGTGATGGGGTAGGG + Intronic
1159428889 18:68325371-68325393 CTGAATTCTTTGCTGGTGGGTGG - Intergenic
1160947623 19:1651112-1651134 CTCCATTCTAAGATGGGGGATGG + Intronic
1161596390 19:5153152-5153174 TTCATTTCCTTGGTGGGGGAGGG + Exonic
1164592842 19:29515617-29515639 CTCACTTCTTTGCTGTGGAAGGG - Intergenic
1164929092 19:32160241-32160263 GATAATTCTTTGCTGGGGGAGGG + Intergenic
1165574773 19:36805664-36805686 CTCTTTTCTTTGGTGGGAGAGGG + Intergenic
926272689 2:11378577-11378599 CTCAGTCCTCTGATGAGGGAGGG + Intergenic
926550605 2:14296329-14296351 CTCAAGTATTTGGTGGGGGTTGG + Intergenic
933478389 2:82821386-82821408 CTCAACTCTTTGATTGCAGATGG - Intergenic
934756463 2:96827994-96828016 CTCAATTGTTTGGGGTGGGAGGG - Intronic
935182762 2:100705219-100705241 CTCCACTCTGTGTTGGGGGATGG - Intergenic
935914752 2:107937003-107937025 TTAAATTGTTTGTTGGGGGAGGG - Intergenic
935973546 2:108555194-108555216 CTTTATTTTTTGAGGGGGGAGGG + Intronic
936529567 2:113266467-113266489 CTCCTTTCTTTGAAGGGTGACGG + Intronic
937003733 2:118492090-118492112 ATCAATTATTTACTGGGGGATGG + Intergenic
938027989 2:127967303-127967325 CACTATTCTTTGATGTGCGAAGG - Intronic
941542143 2:166800260-166800282 CTCAATTATTTGCTAGTGGATGG + Intergenic
945713136 2:213325648-213325670 ATCTATTTTTTGAGGGGGGAAGG + Intronic
945718191 2:213384460-213384482 CTCAAATCTAAGATGGTGGAGGG + Intronic
949062801 2:241970873-241970895 CTAAATTCTTTGGTGGGGTGAGG - Intergenic
1174204732 20:48829963-48829985 CATAACTCTTTGTTGGGGGAGGG + Intergenic
1174432032 20:50477311-50477333 CATAATTCTTTGTTGTGGGAGGG - Intergenic
1174858057 20:54065543-54065565 GACAATTCTTCGCTGGGGGAAGG - Intronic
1176668349 21:9708478-9708500 CTCATTTCTTTGAGGTGTGATGG + Intergenic
1176677135 21:9789701-9789723 ATCAATTCTTTGAAAGAGGAAGG - Intergenic
1178528175 21:33350451-33350473 TTTAATTTTATGATGGGGGAAGG + Intronic
1178864655 21:36317888-36317910 CTTACTTCTTTGATCGGGCATGG + Intergenic
1182005553 22:26956560-26956582 CTCAAATATGTGCTGGGGGAGGG - Intergenic
1182596253 22:31423056-31423078 GTGAATTATTTGGTGGGGGAAGG + Intronic
950326339 3:12113431-12113453 CTCAATTTTTTAAATGGGGAGGG - Intronic
951973464 3:28475444-28475466 CTCATTGCTTTGATGAGGAAAGG - Intronic
952242500 3:31547013-31547035 CTCAATTATTTGGAGGGGAAGGG - Intronic
953242476 3:41161862-41161884 CTCAATTCTGGGATGAGGTAGGG + Intergenic
955502023 3:59594903-59594925 CTCATTTCTTTGTGGGAGGAGGG + Intergenic
956102172 3:65780012-65780034 ATCAATTTTTTGGGGGGGGAAGG + Intronic
959260458 3:104072912-104072934 CTCAGTACTTTGATGGGCCAAGG + Intergenic
959920507 3:111863074-111863096 ATAAATGCTTCGATGGGGGAGGG + Intronic
960174214 3:114497996-114498018 ATAAATTCTGTGATGGAGGAAGG + Intronic
962811342 3:138961595-138961617 ATAAATACTGTGATGGGGGAAGG + Intergenic
962848288 3:139289436-139289458 CTGGATTCTTTGGTGGGGGTGGG + Intronic
966106169 3:176336832-176336854 TTCACTTTTTTGGTGGGGGATGG - Intergenic
966141544 3:176762692-176762714 CTTATTTCTTTGGTGGGGAAAGG - Intergenic
966812317 3:183858003-183858025 CTCATTTCTCAGATGGGGCAAGG - Intronic
967976773 3:195039919-195039941 GCCATTTTTTTGATGGGGGATGG + Intergenic
970248699 4:14091798-14091820 CTCTATGCTTTGATAGGAGAAGG + Intergenic
971214535 4:24650961-24650983 CTGGATACTTTGATGGGGGAAGG + Intergenic
971965497 4:33550308-33550330 CTGAAGAGTTTGATGGGGGATGG - Intergenic
972481980 4:39505542-39505564 CTTAATTTTTTGATTGGGGTAGG - Intronic
973090248 4:46126692-46126714 TGCAATTCTTTGCTGTGGGAGGG - Intergenic
974900456 4:67990140-67990162 GTTAATTCTTTATTGGGGGAGGG - Intergenic
975045070 4:69793114-69793136 GACAATTCTTTGCTGGGGGAAGG + Intergenic
978737964 4:112105891-112105913 CACATTTTTTTGTTGGGGGAGGG - Intergenic
979277340 4:118828618-118828640 ATTAATTCTTCGTTGGGGGAGGG - Intronic
981598031 4:146449320-146449342 CTAAATTCTGTGATGAGGCATGG + Intronic
983931449 4:173457458-173457480 CTCAATTCTTTGATGTTATATGG - Intergenic
984199926 4:176706283-176706305 GTCAAATCTTTGATTAGGGAGGG - Intronic
985398409 4:189569079-189569101 ATCAATTCTTTGAAAGAGGAAGG + Intergenic
985406432 4:189643033-189643055 CTCATTTCTTTGAGGTGTGATGG - Intergenic
985792725 5:1939183-1939205 ATCCATCCTTTCATGGGGGAAGG + Intergenic
986493490 5:8317905-8317927 CGTAATACTCTGATGGGGGAGGG - Intergenic
986781243 5:11067658-11067680 CTCAATTCTTCAATGAGGGCAGG - Intronic
987501910 5:18722328-18722350 CTCAATTCTTTGAAGACTGACGG - Intergenic
989159977 5:38381284-38381306 TTCAGTTCTTTGATGGGAGTAGG + Intronic
996360459 5:122639404-122639426 CTCAATAGCTTGGTGGGGGATGG + Intergenic
996518287 5:124397849-124397871 CTCAATTATTGGTTGAGGGATGG + Intergenic
999032945 5:148314659-148314681 TTCAATTATTTTATGGGGGGTGG - Intronic
1000441826 5:161272603-161272625 CTCAATAATTTGCTGTGGGATGG - Intergenic
1000784840 5:165530083-165530105 CTCACCTCTTTGATAGGAGAAGG + Intergenic
1005385741 6:25282302-25282324 CGCAATTCTTTTTTAGGGGAGGG + Intronic
1007234688 6:40382136-40382158 CTCTATTCTTACATGGCGGATGG + Intergenic
1008515140 6:52311770-52311792 CTAAAGGTTTTGATGGGGGATGG - Intergenic
1009289871 6:61868727-61868749 CCCAACTCCTTGGTGGGGGAGGG - Intronic
1009885433 6:69618625-69618647 CTAAATTCTTTGGTGGGGTGGGG + Intergenic
1012665961 6:101970324-101970346 CTAAATTCTTTCCTGGGTGATGG - Intronic
1012918520 6:105196951-105196973 TTCAATTCTATGATGGCTGAGGG + Intergenic
1013099085 6:106973393-106973415 CTCAATTCTTTGATGGGGGAGGG - Intronic
1013152779 6:107462094-107462116 GATAATTCTTTGTTGGGGGAAGG + Intergenic
1013326812 6:109054074-109054096 CTTAATTTTTTGGGGGGGGAGGG + Intronic
1013371828 6:109477610-109477632 CTCCATTCTCTTTTGGGGGAGGG - Intronic
1013381921 6:109581560-109581582 TTCAATTCTGTGATGGCTGAGGG + Intronic
1015874389 6:137808395-137808417 ATCAATTCTTTGATTGGGAGGGG - Intergenic
1016170690 6:141012072-141012094 CTTAATTCTTTCATGTTGGAAGG - Intergenic
1016359842 6:143255387-143255409 CTCGATTCTTGGCTGGCGGATGG + Intronic
1017521894 6:155209785-155209807 CTCACTTCTAAGATAGGGGAAGG - Intronic
1020875559 7:13689308-13689330 CTTAAGTTTTTGATGAGGGATGG - Intergenic
1021586114 7:22210420-22210442 CTCCTCTCTTTGATGGTGGAGGG + Intronic
1022469932 7:30675887-30675909 CTCAATTCTTTCTGGGGGAAAGG + Intronic
1022637199 7:32147699-32147721 CTCAATGCTTGGAGGGGGGGTGG - Intronic
1023142501 7:37116135-37116157 CTTATTTCTTTGAAGGGGAAAGG - Intronic
1024573280 7:50743113-50743135 CACAATGCATTGATGGGAGAAGG + Intronic
1025698940 7:63798222-63798244 CTCAGTGCTTTGGTGGGTGAAGG - Intergenic
1026383920 7:69826851-69826873 CTCAATAATTTGTTGGAGGAAGG - Intronic
1026403668 7:70042178-70042200 CTCAATTTTTTTTTGGGGGGTGG - Intronic
1026672564 7:72402752-72402774 CATAATTTTTTGGTGGGGGATGG + Intronic
1028112327 7:86956718-86956740 CTTCAATGTTTGATGGGGGAGGG + Intronic
1028745531 7:94322026-94322048 CTCAATTCTGAGATAGGGAATGG - Intergenic
1032538407 7:132683808-132683830 CTCCATTTTTGGAAGGGGGATGG - Intronic
1036528975 8:9564227-9564249 TTCAATTCATTGATGGGGTAGGG - Intronic
1037325841 8:17689252-17689274 CCCAATTATTTGTAGGGGGAGGG + Intronic
1037609931 8:20467382-20467404 ATCAATTGTTTGCTGGTGGATGG + Intergenic
1040939156 8:52815251-52815273 CAGTATTCTTTGATGGAGGAGGG - Intergenic
1041430863 8:57779199-57779221 CTCAACTCTTTGCTGATGGAGGG + Intergenic
1041927222 8:63249265-63249287 CTCAGTTCTTTGATGGTGGTTGG - Intergenic
1042802389 8:72733826-72733848 CTGAATTCTTGGAGGTGGGAAGG + Intronic
1046262726 8:111790902-111790924 CTCAATTCTTTGCTGAGGTTTGG - Intergenic
1049956878 9:701517-701539 GATAATTCTTTGTTGGGGGAAGG + Intronic
1050731251 9:8712710-8712732 ATCAATTCTTTTTTGGGGGGTGG + Intronic
1052671677 9:31565732-31565754 TTCGATTCTTTTAGGGGGGATGG + Intergenic
1052680273 9:31682534-31682556 CTCAACTCTTTCATGTGAGATGG - Intergenic
1052794964 9:32915036-32915058 CTCAATTCCTTCATGTGGGCAGG + Intergenic
1053369999 9:37552793-37552815 CTCTGTTCTTAGATGGTGGAAGG + Intronic
1055766999 9:79674057-79674079 CTCAACTCTTTTATCTGGGAAGG - Intronic
1056272197 9:84957097-84957119 CTCCCTTCCTTGATGGGGGCAGG + Intronic
1056649351 9:88444653-88444675 CTCAATTCTTTGATGATGAATGG + Intronic
1058676400 9:107403961-107403983 CTCACTTCTTAGAGGGGTGAAGG - Intergenic
1061635526 9:131906232-131906254 GTACATTCTTGGATGGGGGAGGG + Intronic
1061853835 9:133430598-133430620 CTCAATTTTTTTGTGGAGGAAGG - Intronic
1203657517 Un_KI270753v1:12477-12499 CTCATTTCTTTGAGGTGTGATGG - Intergenic
1188241864 X:27802214-27802236 CTCTATATTTTGATTGGGGATGG - Intergenic
1189811384 X:44783972-44783994 CTCCATTCTGGGATGGGGAAAGG + Intergenic
1190334809 X:49255853-49255875 CTCAATGCTCTGAATGGGGAGGG + Intronic
1192677127 X:73209739-73209761 GTAAATTCTTTTTTGGGGGAGGG - Intergenic
1198504549 X:137288845-137288867 CTCAATATTTTGAAGTGGGAGGG - Intergenic
1198776871 X:140189037-140189059 CCCACTTTTTTGGTGGGGGAGGG - Intergenic
1201143941 Y:11051966-11051988 TTCAAGTCTTTGGTGGAGGAAGG + Intergenic