ID: 1013106125

View in Genome Browser
Species Human (GRCh38)
Location 6:107028121-107028143
Sequence TCGCTGCTTCGCTGCCGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 131}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1013106118_1013106125 4 Left 1013106118 6:107028094-107028116 CCTCCAAGACGCGGCCTCCAGCA 0: 1
1: 0
2: 1
3: 11
4: 140
Right 1013106125 6:107028121-107028143 TCGCTGCTTCGCTGCCGCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 131
1013106120_1013106125 1 Left 1013106120 6:107028097-107028119 CCAAGACGCGGCCTCCAGCAGGG 0: 1
1: 0
2: 0
3: 18
4: 184
Right 1013106125 6:107028121-107028143 TCGCTGCTTCGCTGCCGCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 131
1013106116_1013106125 13 Left 1013106116 6:107028085-107028107 CCGCGCAGTCCTCCAAGACGCGG 0: 1
1: 0
2: 0
3: 3
4: 47
Right 1013106125 6:107028121-107028143 TCGCTGCTTCGCTGCCGCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 131
1013106115_1013106125 14 Left 1013106115 6:107028084-107028106 CCCGCGCAGTCCTCCAAGACGCG 0: 1
1: 0
2: 0
3: 1
4: 37
Right 1013106125 6:107028121-107028143 TCGCTGCTTCGCTGCCGCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 131
1013106123_1013106125 -10 Left 1013106123 6:107028108-107028130 CCTCCAGCAGGGGTCGCTGCTTC 0: 1
1: 1
2: 3
3: 20
4: 181
Right 1013106125 6:107028121-107028143 TCGCTGCTTCGCTGCCGCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 131
1013106114_1013106125 21 Left 1013106114 6:107028077-107028099 CCTACTTCCCGCGCAGTCCTCCA 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1013106125 6:107028121-107028143 TCGCTGCTTCGCTGCCGCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 131
1013106111_1013106125 28 Left 1013106111 6:107028070-107028092 CCCCGAGCCTACTTCCCGCGCAG 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1013106125 6:107028121-107028143 TCGCTGCTTCGCTGCCGCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 131
1013106112_1013106125 27 Left 1013106112 6:107028071-107028093 CCCGAGCCTACTTCCCGCGCAGT 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1013106125 6:107028121-107028143 TCGCTGCTTCGCTGCCGCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 131
1013106113_1013106125 26 Left 1013106113 6:107028072-107028094 CCGAGCCTACTTCCCGCGCAGTC 0: 1
1: 0
2: 2
3: 5
4: 65
Right 1013106125 6:107028121-107028143 TCGCTGCTTCGCTGCCGCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1013106125 Original CRISPR TCGCTGCTTCGCTGCCGCCC TGG Intergenic
900513379 1:3070456-3070478 TGGCCGCTTCGCTGCAGCCGGGG - Intronic
901655595 1:10767498-10767520 TCTCTGCTTCCCGGCCTCCCTGG - Intronic
904794773 1:33051091-33051113 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
906436877 1:45803817-45803839 GCGCGGCTGCGCTGCGGCCCGGG + Exonic
906486604 1:46240252-46240274 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
910237208 1:85048303-85048325 TCGCTGCCTCCCGGCCTCCCCGG + Intronic
911188826 1:94927671-94927693 CCTCTGCCCCGCTGCCGCCCAGG + Intergenic
912401555 1:109397743-109397765 CCGCTGCGCCGCTGCCGCGCTGG - Exonic
914744524 1:150492039-150492061 TCACTGCATCTCTGCCTCCCGGG + Intronic
915583188 1:156828501-156828523 TCCCTGCTGGGCTGCCTCCCAGG + Intronic
916174179 1:162023927-162023949 TGGCTGCATCTCCGCCGCCCCGG - Intergenic
917904609 1:179576096-179576118 TCTCTGCTTCAGCGCCGCCCCGG - Intergenic
923506621 1:234610325-234610347 GCGCTGCTGCGCTGCCCCGCGGG - Intergenic
924139322 1:241005608-241005630 TCGCTGCAACTCTGCCTCCCAGG + Intronic
1066562000 10:36679602-36679624 TCGCTGGCTCGCTGGCTCCCTGG - Intergenic
1069774432 10:70918555-70918577 CTGCTGCTTCTCTGTCGCCCGGG - Intergenic
1070713727 10:78702448-78702470 CAGCTGCTTCCCTGGCGCCCAGG + Intergenic
1072950172 10:99840350-99840372 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1074184521 10:111089021-111089043 TTGCTGCTTCGCTGCACCCCAGG + Intergenic
1076690287 10:132220242-132220264 CCCCTGCTTCGCTGCCGCGTGGG - Intronic
1089351769 11:117825355-117825377 TTTCTCCTTCCCTGCCGCCCTGG + Intronic
1089380553 11:118028055-118028077 TCCCTGCTTCGCTGTCCCTCTGG + Intergenic
1091284195 11:134399036-134399058 TCTCTGCTTTGCTCCCTCCCCGG + Intronic
1095439296 12:42226950-42226972 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1099854126 12:88142322-88142344 TCGGTCCTTCCCCGCCGCCCCGG - Exonic
1104634390 12:130428419-130428441 TCCCTGCTTCGCTGACTCACGGG + Intronic
1109252196 13:60032579-60032601 TCCCTGCTTCCCTGCCACTCCGG - Intronic
1112058084 13:95709663-95709685 TCGCTCTGTCGCTGTCGCCCAGG + Intronic
1115211188 14:30968602-30968624 TCGCTGCAACTCTGCCTCCCGGG - Intronic
1117636960 14:57754176-57754198 TCGCTGCAACCCTGCCTCCCAGG + Intronic
1119382964 14:74240278-74240300 CCGCTGCTCCACTGCGGCCCCGG + Intronic
1121105106 14:91274320-91274342 TCCCTGCTAAGCTGCCGCCCGGG + Intronic
1121355096 14:93207402-93207424 TCTCGGAGTCGCTGCCGCCCAGG - Exonic
1122364711 14:101187753-101187775 ACGCTGCTTATCTGCCTCCCTGG + Intergenic
1122964070 14:105112920-105112942 GCGCGGCTGCGCTGCGGCCCGGG - Intergenic
1127592348 15:60437692-60437714 TCGCTGCTGCACTCCAGCCCAGG - Intronic
1129853854 15:78810930-78810952 GCGCGGCTTCGCTCCCGGCCCGG + Intronic
1130220634 15:82016666-82016688 TTGGTGCTTCCCTGCCGCCCAGG - Intergenic
1131053509 15:89362698-89362720 CCGCTGCCTCGCTGGGGCCCGGG + Intergenic
1132589793 16:721643-721665 TCGCTGCTGCGAGGACGCCCCGG + Exonic
1132814123 16:1817828-1817850 TTGCTGCTTCGCGGCTGTCCTGG + Intronic
1133105999 16:3509900-3509922 TCGCTGCGCCTCTGCCTCCCAGG + Intronic
1136378611 16:29880029-29880051 TCGCTGCTTCGCCCCCTTCCTGG - Exonic
1136380479 16:29892267-29892289 TCCCTGCTTCGCAGCTGCACTGG - Intronic
1139670819 16:68491664-68491686 CCTCTTCTTCGCTGCCCCCCTGG - Intergenic
1140067968 16:71626350-71626372 TCGCTGCTTCGCTTCCTGCGCGG - Exonic
1140479037 16:75252664-75252686 CCGCTGCTTCCCTGCCACCAGGG - Intronic
1141630452 16:85284799-85284821 TGCCTGCTCCGCTGCCGTCCTGG + Intergenic
1145212372 17:21023705-21023727 TCTGTGCTTCGCTGCCTCCCGGG - Intronic
1147963136 17:44179794-44179816 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1148079143 17:44957912-44957934 TCACTCCATGGCTGCCGCCCAGG + Intergenic
1150423214 17:65056715-65056737 TCGCTGGTTCCCTCCCTCCCTGG - Exonic
1151153093 17:72104723-72104745 TGGCTGTTTCTCTGCAGCCCAGG - Intergenic
1151730498 17:75908421-75908443 TCTCTGCTTGGCTGTCCCCCCGG + Intronic
1157609098 18:48944959-48944981 TCGCTCCTTGGCTGCTCCCCAGG - Intronic
1161170588 19:2810618-2810640 TCTCTCCTTCCCTCCCGCCCAGG + Exonic
1162886642 19:13702551-13702573 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1164191861 19:22925298-22925320 GCGCGGCTGCGCTGCGGCCCAGG + Intergenic
1164653388 19:29901926-29901948 GCGCGGCTGCGCTGCGGCCCGGG - Intergenic
1164993870 19:32705029-32705051 TCACTGCATCTCTGCCTCCCAGG - Intronic
1165743492 19:38217261-38217283 TCGCTCCTTCGCTCCTGGCCGGG - Intronic
1166261380 19:41643977-41643999 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1166751685 19:45166867-45166889 TCTCTGCTTGGCTCCAGCCCTGG + Intronic
925031587 2:654031-654053 TCCCTGCTGTGCTGCAGCCCCGG + Intergenic
925745788 2:7042502-7042524 TGGCTGCTGTACTGCCGCCCAGG + Exonic
932569064 2:72928217-72928239 TCACTGCTTGGGTGCCGCCCTGG + Intronic
943753260 2:191532004-191532026 TGGCTGGTTAGCTGCTGCCCAGG + Intergenic
948060965 2:235043076-235043098 GCGCTCCTTCGCTGACGCCCTGG + Exonic
948888874 2:240897264-240897286 TCTCTGCTTCCATGCCTCCCAGG + Intergenic
949052389 2:241904086-241904108 TCCCTGCCTCCCTGCCTCCCAGG - Intergenic
1175514635 20:59561213-59561235 TTGCTGCTTCTCTGCGTCCCTGG - Intergenic
1179873444 21:44255443-44255465 TCGCTGCACCTCTGCCCCCCGGG - Intronic
1184228267 22:43143178-43143200 TCGCCGCTCCGTCGCCGCCCAGG + Exonic
1185388344 22:50546729-50546751 CCCCTGCTTCGCTCCTGCCCAGG - Intergenic
949388358 3:3530918-3530940 ACGCTGCTTCACTCCAGCCCGGG - Intergenic
950253919 3:11488530-11488552 GCGCCGCTGCGCTGCGGCCCGGG - Intronic
950590463 3:13933012-13933034 GCGCGGCTTCGCTTCCGCTCCGG - Intergenic
956499421 3:69866014-69866036 TGGCTGCTGGGCTGCCTCCCTGG + Intronic
959302278 3:104618557-104618579 TCACTGCATCTCTGCCTCCCAGG - Intergenic
968997205 4:3953399-3953421 TGGCTACTTAGCTGCCACCCAGG + Intergenic
969524446 4:7697041-7697063 TGGCTGCTGCGCTGGGGCCCTGG - Intronic
969816777 4:9692852-9692874 TGGCTACTTAGCTGCCACCCAGG - Intergenic
975420461 4:74158163-74158185 TCGCTGCTCCGCGGCCGCCTTGG + Exonic
978379877 4:108116060-108116082 TCACTGCTGTGCTCCCGCCCAGG + Intronic
979205439 4:118033247-118033269 TTGCAGCCTCGCAGCCGCCCTGG + Intergenic
983922009 4:173356136-173356158 TCACTGCATCTCTGCCTCCCGGG - Intergenic
985579031 5:687084-687106 TGGCTGCGTCACTGCAGCCCCGG - Intronic
989306265 5:39960169-39960191 TCCCTGCTTTGCTGATGCCCAGG - Intergenic
990382977 5:55233689-55233711 TCGCGGCTCCGGTGCCGCTCTGG - Intergenic
992373664 5:76170851-76170873 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
996365501 5:122696379-122696401 TCGCTGCTTCACTCCAGCCTGGG + Intergenic
998260158 5:140624623-140624645 TCGCTGCACCTCTGCCTCCCAGG + Intergenic
1000985194 5:167858621-167858643 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1002341468 5:178519027-178519049 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1002456021 5:179345668-179345690 TCTCTGCTTCGCTGCGAGCCCGG - Intergenic
1002670474 5:180861807-180861829 TCGCTGCCAAGCTGGCGCCCCGG - Intergenic
1006677763 6:35776593-35776615 CCGCCGCTGCTCTGCCGCCCAGG + Exonic
1007498766 6:42279856-42279878 TCGCTTCTTCTCTGGGGCCCTGG - Intronic
1007674483 6:43581777-43581799 GCGCGGCTGCGCTGCGGCCCGGG - Intronic
1013106125 6:107028121-107028143 TCGCTGCTTCGCTGCCGCCCTGG + Intergenic
1015476483 6:133664081-133664103 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1017073995 6:150600658-150600680 TCGCAGAGTCGCGGCCGCCCAGG - Intronic
1019143391 6:169962113-169962135 TCCCTGCTCTGCGGCCGCCCCGG - Intergenic
1019411497 7:908730-908752 CCGCTGCTGCGATGCCTCCCCGG - Intronic
1019637047 7:2081563-2081585 TCCCTGCATCACTGCAGCCCAGG + Intronic
1023758824 7:43444891-43444913 CCTCTGCCGCGCTGCCGCCCTGG - Exonic
1024338300 7:48231702-48231724 TCACTGCTGCACTGCCGCCTGGG - Intronic
1024533247 7:50410218-50410240 TCTCTGCTTTGCTACCCCCCTGG + Intergenic
1024639122 7:51316067-51316089 CCCCGGCTTCGCAGCCGCCCGGG - Intronic
1026111597 7:67462853-67462875 TCCCGGCTTCCCTGCTGCCCTGG - Intergenic
1029223137 7:99005926-99005948 CTGCTGCCTCGCTGGCGCCCAGG - Intronic
1032011864 7:128352211-128352233 GCCCTGCTTGGCTGCCGGCCTGG - Exonic
1032503957 7:132421891-132421913 TCACTGCTTCGCTGCAACCCTGG + Intronic
1033571426 7:142632608-142632630 TTGCTGCCTCGCTGCCGGGCGGG + Intergenic
1034678408 7:152909518-152909540 GAGCTGCATCGCAGCCGCCCTGG + Intergenic
1034944551 7:155253524-155253546 TGTCTGCTTCTCAGCCGCCCTGG - Intergenic
1035708740 8:1696592-1696614 ACGCTGCTGGGCTGCAGCCCTGG - Intronic
1037187947 8:16087684-16087706 TCGCTCTGTCGCTGTCGCCCAGG + Intergenic
1038194780 8:25357451-25357473 TCACTGCGTCTCTGCCTCCCAGG + Intronic
1040018757 8:42721646-42721668 TCACTGCATCTCTGCCTCCCAGG - Intronic
1040278973 8:46028299-46028321 TCGCTGCTTAGTACCCGCCCAGG + Intergenic
1047687066 8:127315671-127315693 GCGCCGCTGCGCTGCGGCCCGGG + Intergenic
1049368023 8:142250102-142250124 ACACTGCTGCGCTGCCGGCCTGG - Intronic
1049799360 8:144510620-144510642 TCGGTGCTGCGCTTCCGCCTCGG + Exonic
1053457017 9:38241342-38241364 GCGCGGCTGCGCTGCGGCCCGGG + Intergenic
1059210809 9:112513502-112513524 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1060064729 9:120494855-120494877 GCGCGGCTGCGCTGCGGCCCGGG + Intronic
1061823594 9:133242556-133242578 TCGCAGCTTTGCTGCTGCCTGGG - Intergenic
1062259971 9:135656715-135656737 TCTCTGCCTCCCTGCCTCCCAGG - Intergenic
1062556338 9:137114824-137114846 TCGCTGCTTCAGCGCCGCGCCGG + Intronic
1062597966 9:137307556-137307578 CAGCTGCTTCTCTGCGGCCCTGG - Intronic
1189030184 X:37442047-37442069 TGTCTTCCTCGCTGCCGCCCAGG - Intronic
1190581376 X:51894960-51894982 CCGCTGCTGCGCTGCCACCCGGG + Intronic
1192235358 X:69292060-69292082 TCGCTGCAACTCTGCCTCCCTGG - Intergenic
1194165661 X:90511861-90511883 TCCCTGCATCCCTGCCTCCCTGG - Intergenic
1195156060 X:102125733-102125755 TCGCTGCTCCCCCGCCGCCTGGG - Exonic
1195158056 X:102142404-102142426 TCGCTGCTCCCCCGCCGCCTGGG + Exonic
1195308401 X:103607985-103608007 TCGCTGCTCCCCCGCTGCCCGGG - Intronic
1199015131 X:142805957-142805979 TCGCTGCACCTCTGCCTCCCAGG - Intergenic
1199458856 X:148060502-148060524 TCACTGCATCTCTGCCTCCCAGG + Intergenic
1200511926 Y:4089657-4089679 TCCCTGCATCCCTGCCTCCCTGG - Intergenic